Relationship Between Prevalence of Pneumococcal Serotypes and Their Neuraminidases in Carriers, Predictive Facts?

AUTHORS

Fatemeh Norolahi 1 , Seyed Davar Siadat 2 , Mohammadali Malekan 1 , Seyed Hamid Mousavi 3 , Alireza Janani 1 , Seyed Fazlollah Mousavi 1 , *

1 Microbiology Department, Pastuer Institute of Iran, Tehran, Iran

2 Department of Mycobacteriology and Pulmonary Research, Microbiology Research Center, Pasteur Institute of Iran, Tehran, Iran

3 Microbiology Department, Azad University, Science and Research Branch, Tehran, Iran

How to Cite: Norolahi F, Siadat S D, Malekan M, Mousavi S H, Janani A, et al. Relationship Between Prevalence of Pneumococcal Serotypes and Their Neuraminidases in Carriers, Predictive Facts?, Arch Pediatr Infect Dis. 2020 ; 8(1):e14100. doi: 10.5812/pedinfect.14100.

ARTICLE INFORMATION

Archives of Pediatric Infectious Diseases: 8 (1); e14100
Published Online: January 20, 2020
Article Type: Research Article
Received: May 27, 2017
Revised: December 11, 2019
Accepted: December 23, 2019
Crossmark
Crossmark
CHECKING
READ FULL TEXT

Abstract

Streptococcus pneumoniae is one of the leading causes of morbidity and mortality worldwide that mainly colonizes the upper respiratory tract in children and produces invasive infections such as meningitis, bacteremia, pneumonia, and otitis media. Pneumococcus species harbor a number of virulent genes that influence disease severity. Neuraminidase is a virulence factor that cleaves sialic acid. Pneumococcal nasopharyngeal carriage is common among healthy individuals and is considered an important transmission source. This topic, however, is less regarded in research from Iran. Therefore, the current study aimed at investigating the prevalence of pneumococcal nasopharyngeal carriage among Iranian children under six years of age. The study also aimed at determining the frequency of pneumococcal serotypes and the neuraminidase virulence genes (nanA, nanB, and nanC) among carriers. A total of 384 nasopharyngeal samples were collected from children under six years of age referred to healthcare centers of six provinces in Iran, including Tehran, Fars, Ardebil, Lorestan, Khorasan, and Sistan va Baluchistan from 2013 to 2016. Of these, 92 carriers were identified (24.0%; 95% confidence interval [CI]: 20.0, 28.5%). Identified pneumococcal serotypes included 6A/B (14.1%), 14, 3, and 19A (each 12.1%), 4, 19F, 23F (each 5.4%), 11 (4.3%), 18C, 22F, 9V, 19, 12, and 33F (each 2.1%), 5, 12F (each 1.1%) and non-typable (14.1%). Frequency of neuraminidase nanA, nanB, and nanC genes among 92 carriers was 100% (95% CI: 96.0, 100%), 85.9% (95% CI: 77.3, 91.6), and 62.0% (95% CI: 51.8, 71.2), respectively. The results showed that about 25% of children (n = 92) were pneumococcus carriers. A wide range of serotypes, some of which are known as virulent, were seen in the population. Prevalence of neuraminidase genes was also considerable.

Copyright © 2020, Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

1. Background

Streptococcus pneumoniae is a human bacterial pathogen considered as one of the main causes of community-acquired pneumonia, meningitis, and bacteremia and is a common cause of mortality worldwide. S. pneumoniae can colonize the upper respiratory tract including nasopharynx. The most common serotypes of S. Pneumoniae are 19F, 6B, 4, 14, 19A, 3, 23F, and 1. Bacterial attachment to host epithelial cells is required for the development of pneumococcal infections (1-4). Pneumococcus has several virulence factors which contribute to the colonization of the host mucosal surfaces (5). Neuraminidase is a virulence factor that cleaves sialic acid into glycoproteins, glycolipids, and oligosaccharides and contributes to pneumococcal pathogenesis in two ways: (1) decrease of the integrity of mucosa and facilitation of bacterial dissemination into lower layers; (2) facilitation of the attachment of surface receptors to host cells and bacterial colonization.

Two types of neuraminidase are encoded by nanA and nanB genes. Also, there is a homologous gene named nanC. The structural analysis of pneumococcal neuraminidases revealed that 50% of NanB and NanC sequences are similar, but 25% of their sequences are similar with that of NanA (6, 7). NanA is the primary virulence factor for the elimination of sialic acid in three types of neuraminidases. It also removes sialic acid from compounds such as lactoferrin and IgA2 protease (8).

NanA also targets the host glycogen molecules and mediates biofilm formation by pneumococci. nanA is upregulated during biofilm development (9). NanB cleaves sialic acid and provides carbon and energy sources for pneumococci growth. NanC function has remained unclear, but it is essential for invasive infections such as meningitis and hemolytic uremic syndrome (10-12). Since the available vaccines are expensive, serotype-dependent, and their immunogenicity is limited to serotypes included in the vaccine, scientists’ endeavors are concentrated on the development of a serotype-independent vaccine.

For this purpose, neuraminidases are studied in some countries, because this molecule has immunogenicity and is preserved in all strains (13). Serotyping of native and prevalent pneumococci in Iran, frequency of neuraminidases in these serotypes, and comparison of the results with those of other studies from other countries are necessary for obtaining more conclusive results for further investigations.

2. Objectives

The current study aimed at investigating the prevalence of pneumococcal nasopharyngeal carriage among unvaccinated children under six years of age in six provinces of Iran. The study also aimed at evaluating the frequency of pneumococcus serotypes and the neuraminidase virulence genes (nanA, nanB, and nanC) among the identified carriers.

3. Methods

The current cross-sectional study was conducted on 384 nasopharyngeal samples collected by sterile Dacron swabs from children under six years old referred to healthcare centers of six Iranian provinces including Tehran, Fars, Ardebil, Lorestan, Khorasan, and Sistan va Baluchistan from September 2013 to December 2016. The samples were then kept in a combined preserving medium (composed of beef extract 0.4 g, agar 1.2 g, casein 1.0 g, and NaCl 0.3 gin 100 mL double distilled water [BBL Co.]). The samples were sent to the Department of Bacteriology at Pasteur Institute of Iran for isolation and diagnosis. The participants were assigned to the three equal age groups of 2 - 24, 25 - 48, and 49 - 72 months. The nasopharyngeal swabs were streaked onto 5% sheep blood chocolate agar (Quelab Cat. No. 1601a) and then incubated at 37ºC in 5% CO2. The suspected pneumococcal colonies were subcultured onto chocolate agar.

3.1. Identification of Pneumococci

Pneumococci were identified based on the results of culture test and colony morphology, Gram staining, and biochemical tests including catalase, bile solubility and susceptibility of bacteria to optochin disks on chocolate agar plates (Mast diagnostics Cat. No. D42). Growth inhibition zones ≥ 14 mm in diameter around the optochin disks were considered as pneumococci. The primary detection of pneumococci was based on the appearance of the green zone of alpha-hemolysis surrounding colonies on chocolate agar, observation of lancet-shaped diplococci in Gram-stained smears and negative results in catalase test (14, 15).

The clearance of turbidity in tubes containing 2-McFarland bacterial suspension and sodium deoxycholate (bile salt) after 15 minutes was considered as pneumococci. The confirmatory method for the detection of pneumococci was based on molecular methods (16-19).

First, pneumococcal DNA was extracted and purified by Qiagen extraction kit (Cat No. 69525; Germany) and then cpsA gene was detected by PCR as the key test for confirmation. Specific primers for cpsA detection were provided as described in Table 1.

Table 1. Polymerase Chain Reaction Primers for the Determination of the Main Pneumococcal Serotypes
SerotypePrimers (5’ - 3’) Reference
1F: CTC TAT AGA ATG GAG TAT ATA AAC TAT GGT TA(20)
R: CCA AAG AAA ATA CTA ACA TTA TCA CAA TAT TGG C
3F: ATG GTG TGA TTT CTC CTA GAT TGG AAA GTA G(20)
R: CTT CTC CAA TTG CTT ACC AAG TGC AAT AAC G
4F: CTG TTA CTT GTT CTG GAC TCT CGA TAA TTG G(20)
R: GCC CAC TCC TGT TAA AAT CCT ACC CGC ATT G
5F: ATA CCT ACA CAA CTT CTG ATT ATG CCT TTG TG(20)
R: GCT CGA TAA ACA TAA TCA ATA TTT GAA AAA GTA TG
6A/BF: AAT TTG TAT TTT ATT CAT GCC TAT ATC TGG(20)
R: TTA GCG GAG ATA ATT TAA AAT GAT GAC TA
7FF: CCT ACG GGA GGA TAT AAA ATT ATT TTT GAG(20)
R: CAA ATA CAC CAC TAT AGG CTG TTG AGA CTA AC
9VF: CTT CGT TAG TTA AAA TTC TAA ATT TTT CTA AG(20)
R: GTC CCA ATA CCA GTC CTT GCA ACA CAA G
10F: GGT GTA GAT TTA CCA TTA GTG TCG GCA GAC(20)
R: GAA TTT CTT CTT TAA GAT TCG GAT ATT TCT C
11F: GGA CAT GTT CAG GTG ATT TCC CAA TAT AGT G(20)
R: GAT TAT GAG TGT AAT TTA TTC CAA CTT CTC CC
12F F: GCA ACA AAC GGC GTG AAA GTA GTT G(20)
R: CAA GAT GAA TAT CAC TAC CAA TAA CAA AAC
14F: CTT GGC GCA GGT GTC AGA ATT CCC TCT AC(20)
R: GCC AAA ATA CTG ACA AAG CTA GAA TAT AGC C
15F: ATT AGT ACA GCT GCT GGA ATA TCT CTT C(20)
R: GAT CTA GTG AAC GTA CTA TTC CAA AC
16F: CTG TTC AGA TAG GCC ATT TAC AGC TTT AAA TC(20)
R: CAT TCC TTT TGT ATA TAG TGC TAG TTC ATC C
18CF: CTT AAT AGC TCT CAT TAT TCT TTT TTT AAG CC(20)
R: TTA TCT GTA AAC CAT ATC AGC ATC TGA AAC
19FF: GTT AAG ATT GCT GAT CGA TTA ATT GAT ATC C(20)
R: GTA ATA TGT CTT TAG GGC GTT TAT GGC GAT AG
19AF: GTT AGT CCT GTT TTA GAT TTA TTT GGT GAT GT(20)
R: GAG CAG TCA ATA AGA TGA GAC GAT AGT TAG
22FF: GAG TAT AGC CAG ATT ATG GCA GTT TTA TTG TC(20)
R: CTC CAG CAC TTG CGC TGG AAA CAA CAG ACA AC
23FF: GTA ACA GTT GCT GTA GAG GGA ATT GGC TTT TC(20)
R: CAC AAC ACC TAA CAC ACG ATG GCT ATA TGA TTC
33FF: GAA GGC AAT CAA TGT GAT TGT GTC GCG(20)
R: CTT CAA AAT GAA GAT TAT AGT ACC CTT CTA C
35BF: GAT AAG TCT GTT GTG GAG ACT TAA AAA GAA TG(20)
R: CTT TCC AGA TAA TTA CAG GTA TTC CTG AAG CAA G

3.2. PCR

The presence of neuraminidase genes in the isolated pneumococci was determined by the detection of cpsA gene using PCR. Using the primers provided for the detection of most prevalent serotypes of pneumococci (Table 2), all the confirmed isolates were then serotyped based on multiplex PCR (20).

Table 2. Polymerase Chain Reaction Primers for the Detection of cpsA and Neuraminidase Genes
GenesPrimersSize of the Gene (bp)Reference
cpsAF: GCA GTA CAG CAG TTT GTT GGA CTG ACC150(20)
R: GAA TAT TTT CAT TAT CAG TCC CAG TC
nanAF: ATAGACGTGCGCAAAATACAGAATCA548(10)
R: GTCGAACTCCAAGCCAATAACTCCT
nanBF: ACTAGGAGCTGTTAATCGTGAAGG492(10)
R: CCAATACCCGCAGGCATAACATC
nanCF: TGGGGTAAGTACAAACAAGAA523(10)
R: CTAATGGTACTGGCGCAAAATCA

The multiplex PCR results were confirmed in the current study using standard strains including ATCC 6305, ATCC 6301, ATCC 49619, ATCC 49136, and ATCC 700677. Multiplex PCR was performed in a total volume of 25 µL as the reaction mixture containing 0.5 µL of dNTPs (10 mM), 0.5 µL of each primer (10 pmol), 2.5 µL of PCR buffer (10×), 1.5 µL of MgCl2 (25 mM), and 0.2 µL of Taq DNA polymerase (5U/µL) (Fermentas/thermofischer USA. Cat. No. EP0402). The PCR cycle was run at 94ºC for four minutes followed by 30 amplification cycles at 94ºC for 45 seconds, 56ºC for 45 seconds, and 72ºC for two minutes. PCR products were electrophoresed on 1% agarose gel at 100 V for one hour; then, they were stained with ethidium bromide and visualized under a UV transilluminator. The primers used for the detection of the three neuraminidase genes in the current study are shown in Table 3.

Table 3. Frequency of Positive Pneumococcus Serotypes in the Six Provinces of Iran
SerotypeProvinces
Tehran (N = 260)Lorestan (N = 260)Ardabil (N = 260)Khorasan (N = 260)Fars (N = 260)Sistan and Baluchestan (N= 260)
No. (%)95%CINo. (%)95%CINo. (%)95%CINo. (%)95%CINo. (%)95%CINo. (%)95%CI
6A/B5 (1.9)0.6 - 43 (1.2)0.2 - 42 (0.8)0 - 31 (0.4)0 - 22 (0.8)0 - 30 (0.0)0 - 2
145 (1.9)0.6 - 40 (0.0)0 - 22 (0.8)0 - 32 (0.8)0 - 32 (0.8)0 - 30 (0.0)0 - 2
36 (2.3)0.9 - 51 (0.4)0 - 21 (0.4)0 - 20 (0.0)0 - 23 (1.2)0.2 - 40 (0.0)0 - 2
19A 4 (1.5)0.4 - 44 (1.5)0.4 - 41 (0.4)0 - 21 (0.4)0 - 21 (0.4)0 - 20 (0.0)0 - 2
44 (1.5)0.4 - 40 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 21 (0.4)0 - 2
19F3 (1.2)0.2 - 40 (0.0)0 - 20 (0.0)0 - 21 (0.4)0 - 21 (0.4)0 - 20 (0.0)0 - 2
23F2 (0.8)0 - 30 (0.0)0 - 20 (0.0)0 - 21 (0.4)0 - 20 (0.0)0 - 22 (0.8)0 - 3
110 (0.0)0 - 20 (0.0)0 - 21 (0.4)0 - 20 (0.0)0 - 20 (0.0)0 - 22 (0.8)0 - 3
18C0 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 21 (0.4)0 - 20 (0.0)0 - 20 (0.0)0 - 2
22F2 (0.8)0 - 30 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 2
9V1 (0.4)0 - 20 (0.0)0 - 20 (0.0)0 - 21 (0.4)0 - 20 (0.0)0 - 20 (0.0)0 - 2
192 (0.8)0 - 30 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 2
121 (0.4)0 - 20 (0.0)0 - 20 (0.0)0 - 21 (0.4)0 - 20 (0.0)0 - 20 (0.0)0 - 2
33F1 (0.4)0 - 20 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 21 (0.4)0 - 2
50 (0.0)0 - 20 (0.0)0 - 21 (0.4)0 - 20 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 2
12F1 (0.4)0 - 20 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 20 (0.0)0 - 2
Non-typable6 (2.3)0.9 - 52 (0.8)0 - 31 (0.4)0 - 22 (0.8)0 - 30 (0.0)0 - 22 (0.8)0 - 3
Total43 (2.8)2 - 3.710 (0.6)0.3 - 1.29 (0.6)0.3 - 1.111 (0.7)0.4 - 1.39 (0.6)0.3 - 1.18 (0.5)0.2 - 1.0

Abbreviations: C, central; E, east; N, north; S, south; W, west

S. pneumoniae ATCC49610 was used as positive control in PCR. Polymerase chain reaction in the present study was performed in a total volume of 25 μL with 1X PCR buffer in 2.5 μL, 0.2 mM of dNTPs, 1 U of Taq DNA polymerase, 1.5 mM of MgCl2, 2.5 μL of each primer, and 1μL of DNA template. Thermocycling was performed in Eppendorf Gradient Mastercycler apparatus with the following steps: 98ºC for 30 seconds (denaturation), 64ºC for 30 seconds (annealing) for nanA and 55ºC for 30 seconds for nanB and nanC, 72ºC for 60 seconds (extension) and final extension at 72ºC for five minutes. Polymerase chain reaction product was electrophoresed on 1% agarose gel at 100 V for one hour. The final PCR products were stained with ethidium bromide and then illustrated by UV light. The DNA bands were analyzed by comparison of the visualized bands with a 100-bp ladder.

To confirm the results of PCR for nanA, nanB, and nanC genes in the current study, two positive PCR products were randomly selected and sequenced with direct Sanger sequencing (Biomatik Co. Canada).

3.3. Statistical Analysis

Data were collected, revised and analyzed by SPSS software (version 16). Frequencies of identified carriers, pneumococcus serotypes, and neuraminidase genes were expressed as number and percentage. The Wilson score interval was used to estimate 95% confidence interval (CI) for the key outcomes (frequencies). Difference in the frequency of pneumococcal nasopharyngeal carriage among six provinces of Iran was determined by the chi-square (χ2) test. P-value less than 0.05 was considered significant.

4. Results

Of the 384 collected swabs, 119 (31%) and 92 (24%) samples were confirmed as pneumococci by phenotypic and genotypic (detection of cpsA gene) assays, respectively (Figure 1). Of the 92 genetically-confirmed pneumococci, the serotype of 79 (86%) isolates was determined using PCR. The most frequent serotype in the studied samples was 6A/B with the frequency of 14.1% (95% CI: 8.5, 22.7%). The least frequent serotypes were 12F and 5, with the frequency of 1.1% each (95% CI: 0.2, 5.9%). The frequency of the identified pneumococcal serotypes in different provinces and overall is presented in Tables 3 and 4, respectively (21).

Gel electrophoresis for cpsA gene as confirmatory test of Pneumococci isolates. M. indicates the 100 bp. ladder marker, lane 1: Standard strain of Pneumococcus for cpsA. (ATCC49610). The lanes 2 - 14 represent suspect alpha-hemolytic streptococci that lanes 6 - 14 were detected as Pneumococci because these lanes indicate the cpsA and the lanes 3 - 5 removed from our study because they were not detected as Pneumococci.
Figure 1. Gel electrophoresis for cpsA gene as confirmatory test of Pneumococci isolates. M. indicates the 100 bp. ladder marker, lane 1: Standard strain of Pneumococcus for cpsA. (ATCC49610). The lanes 2 - 14 represent suspect alpha-hemolytic streptococci that lanes 6 - 14 were detected as Pneumococci because these lanes indicate the cpsA and the lanes 3 - 5 removed from our study because they were not detected as Pneumococci.
Table 4. Frequency of Pneumococcal Serotypes and Neuraminidases Genes in a Sample of Iranian Children Under Six Years of Age (N = 92a)
SerotypesFrequency of SerotypesaFrequency of Neuraminidases Genesb
No. (%)95% CIcnanAnanBnanC
No. (%)95% CIcNo. (%)95% CIcNo. (%)95% CIc
6A/B13 (14.1)8.5, 22.713 (100)77.2, 10012 (92.3)66.7, 98.69 (69.2)42.4, 87.3
1411 (12.1)6.8, 20.211 (100)74.1, 1009 (81.9)52.3, 94.97 (63.7)35.4, 84.8
311 (12.1)6.8, 20.211 (100)74.1, 1008 (72.8)43.4, 90.37 (63.7)35.4, 84.8
19A11 (12.1)6.8, 20.211 (100)74.1, 10011 (100)74.1, 1009 (81.9)52.3, 94.9
45 (5.4)2.3, 12.15 (100)56.6, 1004 (80)37.6, 96.44 (80)37.6, 96.4
19F5 (5.4)2.3, 12.15 (100)56.6, 1003 (60)23.1, 88.23 (60)23.1, 88.2
23F5 (5.4)2.3, 12.15 (100)56.6, 1004 (80)37.6, 96.41 (20)36.2, 62.4
114 (4.3)1.7, 10.74 (100)51.0, 1004 (100)51.0, 1001 (25)4.6, 69.9
18C2 (2.1)0.6, 7.62 (100)34.2, 1002 (100)34.2, 1001 (50)9.5, 90.5
22F2 (2.1)0.6, 7.62 (100)34.2, 1002 (100)34.2, 1002 (100)34.2, 100
9V2 (2.1)0.6, 7.62 (100)34.2, 1002 (100)34.2, 1001 (50)9.5, 90.5
192 (2.1)0.6, 7.62 (100)34.2, 1001 (50)9.5, 90.51 (50)9.5, 90.5
122 (2.1)0.6, 7.62 (100)34.2, 1002 (100)34.2, 1000 (0)0, 65.8
33F2 (2.1)0.6, 7.62 (100)34.2, 1001 (50)9.5, 90.51 (50)9.5, 90.5
51 (1.1)0.2, 5.91 (100)20.7, 1001 (100)20.7, 1001 (100)20.7, 100
12F1 (1.1)0.2, 5.91 (100)20.7, 1001 (100)20.7, 1001 (100)20.7, 100
Non serotypes13 (14.1)8.5, 22.713 (100)77.2, 10012 (92.4)66.7, 98.68 (61.5)35.5, 82.3
Total92 (5.9)4.8, 7.292 (100)96.0, 10079 (85.9)77.3, 91.657 (62.0)51.8, 71.2

aOf 384 swab samples, 92 were genetically confirmed as pneumococci. The numbers presented here show the frequency of each serotype in the sample of 92 pneumococci-positives

bFrequency Neuraminidases genes are presented for each serotype. The total frequency of each Neuraminidases gene among all the 92 samples is also calculated (presented in the ‘Total’ row of this table).

cConfidence intervals are calculated using Wilson Score interval method

The presence of neuraminidase genes was determined in the 92 genetically-confirmed isolates (Figure 2). All the confirmed isolates harbored the nanA gene, but nanB and nanC were only detected in 85.9% and 62.0% of the isolates, respectively. Also, 87% of the samples collectively harbored nanA and nanB, 62% concomitantly carried nanA and nanC, and 55% harbored nanB, nanC, and nanA genes. Furthermore, 13% and 38% of all isolated strains did not carry nanB and nanC genes, respectively. Table 4 illustrates detailed data on the frequency of different serotypes.

(A) Electerophoresis gel of nanA gene PCR. Lane 1: 100-bp ladder, lane 2: negative control, lane 3: positive control, lanes 4 - 12 represent test isolates. (nanA gene size: 548 bp). (B) Electerophoresis gel of nanB PCR. Lane 1: 100-bp ladder, lane 2: negative control, lane 3: positive control, lanes 4 - 10: represent test samples, lane 8: negative for nanB. (nanB gene size: 492 bp). (C) Electerophoresis gel of nanC PCR. Lane1: 100-bp ladder, lane 2: negative control, lane 3: positive control, lanes 6, 10 and 11 were negative samples.
Figure 2. (A) Electerophoresis gel of nanA gene PCR. Lane 1: 100-bp ladder, lane 2: negative control, lane 3: positive control, lanes 4 - 12 represent test isolates. (nanA gene size: 548 bp). (B) Electerophoresis gel of nanB PCR. Lane 1: 100-bp ladder, lane 2: negative control, lane 3: positive control, lanes 4 - 10: represent test samples, lane 8: negative for nanB. (nanB gene size: 492 bp). (C) Electerophoresis gel of nanC PCR. Lane1: 100-bp ladder, lane 2: negative control, lane 3: positive control, lanes 6, 10 and 11 were negative samples.

5. Discussion

Pneumococcal infections are increasing after the emergence of non-vaccine serotypes, capsule switching, and replacement of new serotypes among different communities (22). There are two types of vaccines (i.e., conjugate and polysaccharide) to prevent pneumococcal infections with each covering partial and limited groups of serotypes (23-25). Different serotypes have distinct geographical distributions. Pneumococci express several types of antigens and virulence factors that help them cause infections in humans. One of these antigens is neuraminidase enzyme (Nan) that hydrolyses the neuraminic acids on human cell surfaces. Pneumococci express three variants of neuraminidase. Several pneumococcal proteins and antigens are selected as vaccine candidates including neuraminidases.

The presence of Nan variants, NanA, NanB and NanC, varies among serotypes. Determination of the frequency of Nan variants in native serotypes is important for vaccine studies; thus, the prevalence of different serotypes and nan genes was investigated in the current research. Four serotypes (i.e., 19A, 6, 3, 23F) of S. pneumoniae accounted for 55.7% of all strains isolated from both nasal carriage and clinical samples in Tehran. Serotype 19A was the most frequent one in the two groups of samples (21, 26).

Vaccine serotypes used in conventional vaccines cover only the American serotypes and is ineffective for other geographical serotypes (27). Since the production of conjugated vaccines is expensive, there is a great limitation for the usage of all serotypes in these vaccines. They are produced in limited numbers from polysaccharides (28). To develop an effective vaccine and eliminate remarked conflicts, it is recommended to focus on protein-based extending vaccines as ideal alternatives for conventional vaccines. Thus, the virulence factors of pneumococcus, except the capsule, could be promising vaccine candidates.

As mentioned earlier, neuraminidases are pneumococcal proteins that play key roles in bacterial colonization in the early stages of infection and invasion to organs such as the central nervous system and the incidence of hemolytic uremic syndrome in infected patients (29-31). Thus, determination of the prevalence of neuraminidase genes in Iranian strains is of great importance. The prevalence of neuraminidase genes and its relationship with pneumococcal serotypes in native strains as the main objectives of the current study were determined by PCR.

Serotyping results of the current study were compared with those of other studies performed worldwide in order to explore differences and similarities; for example, Pai et al. (20) perfectly studied isolates of pneumococci by multiplex PCR, and the comparison of the results with those of the current study showed that pneumococcal serotypes were more prevalent in Iran. It can be concluded that the numbers of isolates, nanA, nanB, nanC, and serotypes according to the sampling site are comparable and the analysis of the results indicates that nanA and nanB distribution was not different among distinct serotypes, but results indicated that the presence of nanC was higher in invasive serotypes.

The investigation of pneumococcal virulence factors can provide more information as to its pathogenesis and lead to the development of more appropriate vaccine candidates for the prevention of pneumococcal diseases. Proper vaccines based on neuraminidase proteins (i.e., NanA, NanB and NanC) as pneumococcal virulence factors can result in more immunity, cost-saving and resolutions for some failures in developing pneumococcal vaccines. The prevalence of neuraminidase genes in clinical isolates and expression of these genes can also be evaluated for obtaining more information.

5.1. Conclusion

The analysis of the current study results indicated a correlation between pneumococcal serotypes and the prevalence of nanA and nanB genes; nanA gene was detected in 100%, nanB in 85.9%, and nanC in 62% of the isolated strains. Although the serotypes 4 and 12F were the most frequent ones in strains isolated from invasive infections, only one strain identified as serotype 12F harbored three neuraminidase genes. The prevalence rate of nanC gene in some serotypes found in the current study including 19A, 6A/B, 19F, and 22F was respectively 81.9%, 69.2%, 60%, and 100%. Some other serotypes such as 18C, 5, 12F, 19, and 19V were scarce, but could be the causes of pneumococcal invasive infections. Since a limited number of serotypes were identified in the current study, for certainty about lack of correlation between pneumococcal serotypes and neuraminidase genes, conducting further extensive studies is recommended.

Acknowledgements

Footnotes

References

  • 1.

    van der Poll T, Opal SM. Pathogenesis, treatment, and prevention of pneumococcal pneumonia. Lancet. 2009;374(9700):1543-56. doi: 10.1016/S0140-6736(09)61114-4. [PubMed: 19880020].

  • 2.

    Shea KM, Edelsberg J, Weycker D, Farkouh RA, Strutton DR, Pelton SI. Rates of pneumococcal disease in adults with chronic medical conditions. Open Forum Infect Dis. 2014;1(1):ofu024. doi: 10.1093/ofid/ofu024. [PubMed: 25734097]. [PubMed Central: PMC4324183].

  • 3.

    Grau I, Ardanuy C, Calatayud L, Schulze MH, Linares J, Pallares R. Smoking and alcohol abuse are the most preventable risk factors for invasive pneumonia and other pneumococcal infections. Int J Infect Dis. 2014;25:59-64. doi: 10.1016/j.ijid.2013.12.013. [PubMed: 24853638].

  • 4.

    O'Brien KL, Wolfson LJ, Watt JP, Henkle E, Deloria-Knoll M, McCall N, et al. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: Global estimates. Lancet. 2009;374(9693):893-902. doi: 10.1016/S0140-6736(09)61204-6. [PubMed: 19748398].

  • 5.

    Kadioglu A, Weiser JN, Paton JC, Andrew PW. The role of Streptococcus pneumoniae virulence factors in host respiratory colonization and disease. Nat Rev Microbiol. 2008;6(4):288-301. doi: 10.1038/nrmicro1871. [PubMed: 18340341].

  • 6.

    Pettigrew MM, Fennie KP, York MP, Daniels J, Ghaffar F. Variation in the presence of neuraminidase genes among Streptococcus pneumoniae isolates with identical sequence types. Infect Immun. 2006;74(6):3360-5. doi: 10.1128/IAI.01442-05. [PubMed: 16714565]. [PubMed Central: PMC1479257].

  • 7.

    Owen CD, Lukacik P, Potter JA, Sleator O, Taylor GL, Walsh MA. Streptococcus pneumoniae NanC: Structural insights into the specificity and mechanism of a sialidase that produces a sialidase inhibitor. J Biol Chem. 2015;290(46):27736-48. doi: 10.1074/jbc.M115.673632. [PubMed: 26370075]. [PubMed Central: PMC4646021].

  • 8.

    Manco S, Hernon F, Yesilkaya H, Paton JC, Andrew PW, Kadioglu A. Pneumococcal neuraminidases A and B both have essential roles during infection of the respiratory tract and sepsis. Infect Immun. 2006;74(7):4014-20. doi: 10.1128/IAI.01237-05. [PubMed: 16790774]. [PubMed Central: PMC1489734].

  • 9.

    Marks LR, Davidson BA, Knight PR, Hakansson AP. Interkingdom signaling induces Streptococcus pneumoniae biofilm dispersion and transition from asymptomatic colonization to disease. mBio. 2013;4(4). doi: 10.1128/mBio.00438-13. [PubMed: 23882016]. [PubMed Central: PMC3735180].

  • 10.

    Gut H, King SJ, Walsh MA. Structural and functional studies of Streptococcus pneumoniae neuraminidase B: An intramolecular trans-sialidase. FEBS Lett. 2008;582(23-24):3348-52. doi: 10.1016/j.febslet.2008.08.026. [PubMed: 18775704].

  • 11.

    Mook-Kanamori BB, Geldhoff M, van der Poll T, van de Beek D. Pathogenesis and pathophysiology of pneumococcal meningitis. Clin Microbiol Rev. 2011;24(3):557-91. doi: 10.1128/CMR.00008-11. [PubMed: 21734248]. [PubMed Central: PMC3131058].

  • 12.

    Koedel U, Angele B, Rupprecht T, Wagner H, Roggenkamp A, Pfister HW, et al. Toll-like receptor 2 participates in mediation of immune response in experimental pneumococcal meningitis. J Immunol. 2003;170(1):438-44. doi: 10.4049/jimmunol.170.1.438. [PubMed: 12496429].

  • 13.

    Moffitt KL, Malley R. Next generation pneumococcal vaccines. Curr Opin Immunol. 2011;23(3):407-13. doi: 10.1016/j.coi.2011.04.002. [PubMed: 21514128]. [PubMed Central: PMC3109250].

  • 14.

    Michelow IC, Lozano J, Olsen K, Goto C, Rollins NK, Ghaffar F, et al. Diagnosis of Streptococcus pneumoniae lower respiratory infection in hospitalized children by culture, polymerase chain reaction, serological testing, and urinary antigen detection. Clin Infect Dis. 2002;34(1):E1-11. doi: 10.1086/324358. [PubMed: 11731965].

  • 15.

    Pikis A, Campos JM, Rodriguez WJ, Keith JM. Optochin resistance in Streptococcus pneumoniae: mechanism, significance, and clinical implications. J Infect Dis. 2001;184(5):582-90. doi: 10.1086/322803. [PubMed: 11474432].

  • 16.

    Lang AL, McNeil SA, Hatchette TF, Elsherif M, Martin I, LeBlanc JJ. Detection and prediction of Streptococcus pneumoniae serotypes directly from nasopharyngeal swabs using PCR. J Med Microbiol. 2015;64(8):836-44. doi: 10.1099/jmm.0.000097. [PubMed: 26066632].

  • 17.

    Saha SK, Darmstadt GL, Baqui AH, Hossain B, Islam M, Foster D, et al. Identification of serotype in culture negative pneumococcal meningitis using sequential multiplex PCR: Implication for surveillance and vaccine design. PLoS One. 2008;3(10). e3576. doi: 10.1371/journal.pone.0003576. [PubMed: 18974887]. [PubMed Central: PMC2571985].

  • 18.

    Satzke C, Turner P, Virolainen-Julkunen A, Adrian PV, Antonio M, Hare KM, et al. Standard method for detecting upper respiratory carriage of Streptococcus pneumoniae: updated recommendations from the World Health Organization Pneumococcal Carriage Working Group. Vaccine. 2013;32(1):165-79. doi: 10.1016/j.vaccine.2013.08.062. [PubMed: 24331112].

  • 19.

    Werno AM, Murdoch DR. Medical microbiology: Laboratory diagnosis of invasive pneumococcal disease. Clin Infect Dis. 2008;46(6):926-32. doi: 10.1086/528798. [PubMed: 18260752].

  • 20.

    Pai R, Gertz RE, Beall B. Sequential multiplex PCR approach for determining capsular serotypes of Streptococcus pneumoniae isolates. J Clin Microbiol. 2006;44(1):124-31. doi: 10.1128/JCM.44.1.124-131.2006. [PubMed: 16390959]. [PubMed Central: PMC1351965].

  • 21.

    Mousavi SF, Nobari S, Rahmati Ghezelgeh F, Lyriai H, Jalali P, Shahcheraghi F, et al. Serotyping of Streptococcus pneumoniae isolated from Tehran by Multiplex PCR: Are serotypes of clinical and carrier isolates identical? Iran J Microbiol. 2013;5(3):220-6. [PubMed: 24475327]. [PubMed Central: PMC3895558].

  • 22.

    Feikin DR, Kagucia EW, Loo JD, Link-Gelles R, Puhan MA, Cherian T, et al. Serotype-specific changes in invasive pneumococcal disease after pneumococcal conjugate vaccine introduction: A pooled analysis of multiple surveillance sites. PLoS Med. 2013;10(9). e1001517. doi: 10.1371/journal.pmed.1001517. [PubMed: 24086113]. [PubMed Central: PMC3782411].

  • 23.

    Azzari C, Resti M. Reduction of carriage and transmission of Streptococcus pneumoniae: The beneficial "side effect" of pneumococcal conjugate vaccine. Clin Infect Dis. 2008;47(8):997-9. doi: 10.1086/591967. [PubMed: 18781870].

  • 24.

    Jackson LA, Gurtman A, Rice K, Pauksens K, Greenberg RN, Jones TR, et al. Immunogenicity and safety of a 13-valent pneumococcal conjugate vaccine in adults 70 years of age and older previously vaccinated with 23-valent pneumococcal polysaccharide vaccine. Vaccine. 2013;31(35):3585-93. doi: 10.1016/j.vaccine.2013.05.010. [PubMed: 23688527].

  • 25.

    Whitney CG, Farley MM, Hadler J, Harrison LH, Bennett NM, Lynfield R, et al. Decline in invasive pneumococcal disease after the introduction of protein-polysaccharide conjugate vaccine. N Engl J Med. 2003;348(18):1737-46. doi: 10.1056/NEJMoa022823. [PubMed: 12724479].

  • 26.

    Houri H, Tabatabaei SR, Saee Y, Fallah F, Rahbar M, Karimi A. Distribution of capsular types and drug resistance patterns of invasive pediatric Streptococcus pneumoniae isolates in Teheran, Iran. Int J Infect Dis. 2017;57:21-6. doi: 10.1016/j.ijid.2017.01.020. [PubMed: 28131730].

  • 27.

    Roca A, Bottomley C, Hill PC, Bojang A, Egere U, Antonio M, et al. Effect of age and vaccination with a pneumococcal conjugate vaccine on the density of pneumococcal nasopharyngeal carriage. Clin Infect Dis. 2012;55(6):816-24. doi: 10.1093/cid/cis554. [PubMed: 22700830]. [PubMed Central: PMC3423933].

  • 28.

    Nurhonen M, Auranen K. Optimal serotype compositions for Pneumococcal conjugate vaccination under serotype replacement. PLoS Comput Biol. 2014;10(2). e1003477. doi: 10.1371/journal.pcbi.1003477. [PubMed: 24550722]. [PubMed Central: PMC3923658].

  • 29.

    Blumental S, Granger-Farbos A, Moisi JC, Soullie B, Leroy P, Njanpop-Lafourcade BM, et al. Virulence Factors of Streptococcus pneumoniae. Comparison between African and French invasive isolates and implication for future vaccines. PLoS One. 2015;10(7). e0133885. doi: 10.1371/journal.pone.0133885. [PubMed: 26214695]. [PubMed Central: PMC4516325].

  • 30.

    Smith A, Johnston C, Inverarity D, Slack M, Paterson GK, Diggle M, et al. Investigating the role of pneumococcal neuraminidase A activity in isolates from pneumococcal haemolytic uraemic syndrome. J Med Microbiol. 2013;62(Pt 11):1735-42. doi: 10.1099/jmm.0.063479-0. [PubMed: 23924664].

  • 31.

    Simell B, Jaakkola T, Lahdenkari M, Briles D, Hollingshead S, Kilpi TM, et al. Serum antibodies to pneumococcal neuraminidase NanA in relation to pneumococcal carriage and acute otitis media. Clin Vaccine Immunol. 2006;13(10):1177-9. doi: 10.1128/CVI.00257-06. [PubMed: 16928889]. [PubMed Central: PMC1595316].

  • COMMENTS

    LEAVE A COMMENT HERE: