Association of Genetic Variation of CIITA and NTCP with Chronic Hepatitis B Virus Infection in Han Chinese Populations

AUTHORS

Mingkuan Su 1 , Huijuan Chen 2 , Yongbin Zeng 2 , Tianbin Chen 2 , Jing Chen 2 , Ling Jiang 2 , Can Liu 2 , Bin Yang 2 , Qishui Ou 2 , *

1 Department of Laboratory Medicine, Mindong Hospital of Ningde City, Fuan, China

2 Department of Laboratory Medicine, the First Affiliated Hospital of Fujian Medical University, Fuzhou, China

How to Cite: Su M, Chen H, Zeng Y, Chen T, Chen J, et al. Association of Genetic Variation of CIITA and NTCP with Chronic Hepatitis B Virus Infection in Han Chinese Populations, Hepat Mon. 2017 ; 17(6):e33646. doi: 10.5812/hepatmon.33646.

ARTICLE INFORMATION

Hepatitis Monthly: 17 (6); e33646
Published Online: February 25, 2017
Article Type: Research Article
Received: October 6, 2015
Revised: January 11, 2017
Accepted: February 7, 2017
Crossmark
Crossmark
CHECKING
READ FULL TEXT

Abstract

Background: The CIITA plays a pivotal role in immune response by controlling HLA class II gene expression, and NTCP is a functional receptor for HBV. These variants may affect outcomes of HBV infection.

Objectives: The aim of this study was to determine the association of CIITA and NTCP gene variants with chronic HBV infection and disease progression.

Methods: Based on serological and clinical characteristics, 671 unrelated Han Chinese individuals were divided into three major groups: healthy subjects (170 cases), clearance subjects (199 cases), and subjects with chronic HBV infection (305 cases) consisted of 169 chronic hepatitis B, 68 liver cirrhosis, and 68 hepatocellular carcinoma patients. By logistic regression analysis, the rs2296651 AG + AA genotype decreased significantly in the chronic HBV infection group when compared to healthy subjects in dominant genetic models (OR = 0.41, 95%CI: 0.23 - 0.74). The rs9302456 CT + TT genotype and rs12882299 CT + CC significantly increased the risk of chronic HBV infection when compared to healthy subjects in dominant genetic models (rs9302456: OR = 2.24, 95%CI: 1.17 - 4.29; rs12882299: OR = 1.97, 95%CI: 1.27 - 3.07). Using the chronic hepatitis B patients as control group, our study showed that there was no association between CIITA and NTCP gene variants and HBV progression.

Conclusions: Our study suggested that genetic variations in CIITA and NTCP were significantly associated with chronic HBV infection in Han Chinese populations, but not with HBV progression.

1. Background

Hepatitis B virus (HBV) infection remains a major public health problem in the world. Although effective vaccine is available, there are still about a million new infections annually and about 240 million chronic infections worldwide (1). The clinical outcome of HBV infection varies from spontaneous recovery to persistent infection that may increasingly progress to liver cirrhosis (LC) and/or hepatocelluar carcinoma (HCC) (2). Studies have shown that the polymorphism of the genes correlated with the host immunological function plays an important role in the progression of chronic HBV infection (3). Human leukocyte antigen (HLA) class II gene polymorphism has been confirmed to be associated with the outcome of HBV infection by some researchers (4-6). Class II transactivator (CIITA) is the master regulator of HLA-II gene expression. It regulates whether HLA-II gene expression or the expression level of HLA-II molecule so as to affect the outcome of HBV infection (7).

HBV exhibits remarkable host specificity and liver tropism. Until now, the mechanism of HBV particles entry into the host hepatocytes is still enigmatic (8), although more than a dozen host-binding proteins, such as preS1, preS2, and S domains, have been identified in the last two decades. In 2012, Yan et al. (9) demonstrated that sodium taurocholate cotransporting polypeptide (NTCP) is a functional receptor for HBV, and it is crucial for binding to the receptor-binding region of the pre-S1 domain of the L protein of HBV and critically contributed to NTCP-mediated HBV infection.

So far, there are a few reports about the association between single nucleotide polymorphisms (SNPs) of CIITA NTCP and chronic HBV infection. Therefore, we conducted a case-control study to investigate the influence of CIITA and NTCP gene variants on chronic HBV infection as well as the disease progression.

2. Objectives

This study aimed to determine the association of CIITA and NTCP gene variants with HBV infection as well as the disease progression.

3. Methods

3.1. Study Subjects

A total of 671 unrelated Han Chinese were recruited for this study between October 2012 and April 2014 (Table 1). Written informed consent was obtained from all the subjects, and the study was performed with the approval of the ethics committee of the first affiliated hospital of Fujian Medical University. Chronic HBV infection subjects were divided into three groups: a) Chronic hepatitis B group (CHB); b) LC group; and c) HCC group. The diagnosis of CHB was based on seropositivity for HBsAg and persistently elevated levels of serum aminotransferase for longer than six months, in accordance with the criteria issued by the Chinese society of hepatology and the Chinese society of infectious diseases in 2010 (10). LC and HCC patients were diagnosed according to the criteria as previously described (11). Clearance subjects were negative for HBsAg and positive for both HBsAb and HBcAb, while they were normal in the indicators of liver function. The subjects who were positive for HBsAb and negative for HBcAb were excluded because of their possible history of vaccination. The healthy subjects had normal indicators of liver function and negative HBV serological markers. Subjects who had any other type of liver diseases such as autoimmune liver disease and alcoholic liver disease and those infected with hepatitis C virus and human immunodeficiency virus were excluded from the study.

Table 1. Characteristics of the Study Population
CharacteristicsHealthy Subjects (n = 170)Clearance Subjects (n = 199)Chronic HBV Infection Subjects (n = 305)
CHB (n = 169)LC (n = 68)HCC (n = 68)
Gender
Malea77 (45.3)94 (47.2)105 (62.1)53 (77.9)58 (85.3)
Femalea93 (54.7)105 (52.8)64 (37.9)15 (22.1)10 (14.7)
Ageb45.5 ± 10.145.4 ± 11.334.1 ± 9.752.1 ± 10.956.2 ± 12.2
HBsAg (-/+)170/0199/00/1690/680/68
HBsAb (-/+)170/00/199169/068/068/0
HBeAg (-/+)170/0199/059/11050/1849/19
HBeAb (-/+)170/0199/0110/5918/5019/49
HBcAb (-/+)170/00/1990/1690/680/68

Abbreviations: CHB, Chronic Hepatitis B; HCC, Heptocellular Carcinoma; LC, Liver Cirrhosis.

aValues are expressed as No. (%).

bValues are expresse as Mean ± SD.

3.2. SNPs Selection

We chose six SNPs for CIITA, five of which (rs7404672, rs9302456, rs3087456, rs12928665, and rs12932187) located in the promoter, and the sixth one (rs4774) in exon 11. For NTCP, we selected tagger SNPs using the genotype data of the sample of Han Chinese in Beijing, China, from the International HapMap Project database using Haploview 4.2 and the criteria: minor allele frequency (MAF) ≥ 0.02; and R2 ≥ 0.8, which was according to HapMap Data Rel 28 PhaseII + III, August 10, on NCBI B36 assembly, dbSNP b126. Four SNPs (rs2296651, rs11622925, rs4646287, and rs12882299) were identified near the region of NTCP gene on chromosome 14.

3.3. SNPs Genotyping

Genomic DNA was extracted from 2 ml of EDTA-anticoagulated peripheral blood samples using a TIANamp DNA Kit (Tiangen Biotech Co., Ltd., China) according to the manufacturer’s instructions. The SNPs genotyping work was performed using an improved multiplex ligation detection reaction (iMLDR) technique (12), which was recently developed by Genesky Biotechnologies Inc. (Shanghai, China). The iMLDR is an improved multiplex SNP discrimination technology based on the traditional ligation detection reaction (LDR). Ten SNPs were amplified in a system with multiplex PCR. The amplified products had been purified with ExoI/SAP before they were applied to the template for a subsequent ligase detection reaction. In a connection reaction, each site included two 5’ terminal allele-specific probes, followed by a 3’ terminal fluorescently labeled specific probe. All primers, probes, and labeling oligos were designed by and ordered from Genesky Biotechnologies Inc. The primer and probe information in two mixtures is described in Tables 2 and 3, respectively.

Table 2. The Primer Sequence and Concentration in PCR Mixture
Primer NamePrimer ConcentrationPrimer Sequence
rs7404672F1 μMTTTCCCTGCATTCCTACCAGCTA
rs7404672R1 μMGCTTTTTGGTGAAAGAGCACTGG
rs9302456F1 μMAGGTGCCAAAGTGCATCCTCTG
rs9302456R1 μMGTGACTGCAGCTGCCTGGTACA
rs3087456F1 μMTGTTGAAGGTTCCCCCAACAGA
rs3087456R1 μMCCCAGCTCAGAAGCACACAGC
rs12928665F2 μMCAGGGGTCTGGACAAGGAGGTT
rs12928665R2 μMCGTGGAAGGCAACTGTGCTTTTA
rs12932187F1 μMAGGGTGTGCCCCTGAAGAAGTC
rs12932187R1 μMTTAAGGCTGCACCCAACCACAC
rs4774F1 μMTATGGCCTGCAGGATCTGCTCT
rs4774R1 μMGCCTTGCTCAGGCTCTGGAC
rs2296651F1 μMGTCCCTGCTAGAAACTTGCTTGTTG
rs2296651R1 μMTGGTAGCAGCACTGGGACAAAG
rs11622925F1 μMCAGGGGTCTGGACAAGGAGGTT
rs11622925R1 μMCGTGGAAGGCAACTGTGCTTTTA
rs4646287F1 μMTCTCCCCAGTTTGGAAGGATGA
rs4646287R1 μMAGAGTTTCCCAGCACCCACTCC
rs12882299F2 μMCATTGCCACATGGCACATTCAC
rs12882299R2 μMGCCATGCAAATTGGGCAGATTA
Table 3. The Probe Sequence and Concentration in Probe Mixture
Probe NameProbe ConcentrationProbe Sequence
rs7404672FC1 μMTTCCGCGTTCGGACTGATATCCTACCA
GCTAAGCCCCCTTTACTAC
rs7404672FT1 μMTACGGTTATTCGGGCTCCTGTCCTACC
AGCTAAGCCCCCTTTACCAT
rs7404672FP2 μMAATCCATCAGCAGGTCCAGGTTTTTTT
rs9302456FC1 μMTCTCTCGGGTCAATTCGTCCTTGGATG
TCACTTGCTCTGCTCAGAGTCC
rs9302456FT1 μMTGTTCGTGGGCCGGATTAGTGGATGTC
ACTTGCTCTGCTCAGAGTCT
rs9302456FP2 μMTGCACYGACACAGGCATGGTTTTTTT
rs3087456RA1 μMTACGGTTATTCGGGCTCCTGTCCACAC
TCCCTTAAGCCCTCACT
rs3087456RG1 μMTTCCGCGTTCGGACTGATATCCACACT
CCCTTAAGCCCTCACC
rs3087456RP2 μMACACCTCTGAAATTAATTTCACTTCCT
TACTGTTTT
rs12928665RA1 μMTACGGTTATTCGGGCTCCTGTGCCCGA
AAGTCTGACTTCTAGAACGTT
rs12928665RG1 μMTTCCGCGTTCGGACTGATATGCCCGAA
AGTCTGACTTCTAGAACATC
rs12928665RP2 μMTCGGTGCTGATACATGGTTCATACTTTT
rs12932187FC1 μMTGTTCGTGGGCCGGATTAGTGCCCCTGA
AGAAGTCGTTTACATTGTC
rs12932187FG1 μMTCTCTCGGGTCAATTCGTCCTTGCCCCT
GAAGAAGTCGTTTACATTGTG
rs12932187FP2 μMGAGTCAATTTTCCTGGAGTGTACAATGTT
rs4774RC1 μMTGTTCGTGGGCCGGATTAGTCGCTTCCAG
CTCCTCGATGC
rs4774RG1 μMTCTCTCGGGTCAATTCGTCCTTCGCTTCC
AGCTCCTCGATGG
rs4774RP2 μMCGTCTAGGATGAGCAGAACGCGTTTTT
rs2296651RA1 μMTGTTCGTGGGCCGGATTAGTGGATGCCAAAAT
GTCCAACTCTGGTT
rs2296651RG1 μMTCTCTCGGGTCAATTCGTCCTTGGATGCCAAA
ATGTCCAACTCTGATC
rs2296651RP2 μMCACCATCCTCAATGTGGCCTTTTT
rs11622925FC1 μMTTCCGCGTTCGGACTGATATGTGGCCACTGGC
GATGGTGC
rs11622925FT1 μMTACGGTTATTCGGGCTCCTGTGTGGCCACTGG
CGATGGTGT
rs11622925FP2 μMTGGGACATCTGGCCACTCACTTTTTTT
rs4646287RC1 μMTTCCGCGTTCGGACTGATATAAGCAGAAATCA
GCAAGGGCACG
rs4646287RT1 μMTACGGTTATTCGGGCTCCTGTAAGCAGAAATC
AGCAAGGGCACA
rs4646287RP2 μMCTCCTGGAGACRCAGCACACTTTTTTTT
rs12882299RC1 μMTCTCTCGGGTCAATTCGTCCTTTCTATTTTTA
TTGCTTTGTTGTCCAAGGTTG
rs12882299RT1 μMTGTTCGTGGGCCGGATTAGTTCTATTTTTATT
GCTTTGTTGTCCAAGGCTA
rs12882299RP2 μMTGATTGGTATAATTTTATTTTTGTTTTTTGCA

3.4. Statistical Analysis

The Hard-Weinberg equilibrium of genotypes was evaluated by using Arlequin 3.5. Linkage disequilibrium (LD) was assessed by Haploview 4.2 using frequencies obtained from the healthy subjects. Odds ratios (OR) and 95% confidence intervals (CI) were calculated on the basis of the binary logistic regression analysis (adjustment for gender and age). All the statistical analyses were performed by SPSS software version 20.0 and P < 0.05 in a two sided test was considered statistically significant.

4. Results

4.1. H-W Equilibrium Test and LD Analyses

The genotype frequencies of CIITA and NTCP genes in the control subjects were confirmed to be in H - W equilibrium (P > 0.05), except for rs7404672, rs3087456, and rs11622925 in the clearance subjects and rs2296651 in the healthy subjects. LD analyses performed on all individuals from the healthy group showed that the R2 value of each pair of SNPs was less than 0.80 (Figures 1 and 2).

Figure 1. The LD Plot Indicating R2 Values Between Each Pair of SNPs in CIITA Gene
Figure 2. The LD Plot Indicating R2 Values Between Each Pair of SNPs in NTCP Gene

4.2. CIITA and NTCP Loci Polymorphisms and Chronic HBV Infection

The dominant model was selected for further study because some SNPs had lower frequencies of homozygous genotype mutation. CIITA rs9302456 CT+TT genotype was significantly higher in the chronic HBV infection than healthy subjects (OR = 2.24, 95%CI: 1.17 - 4.29). NTCP rs2296651 AG + AA genotype decreased significantly in the chronic HBV infection than healthy subjects (OR = 0.41, 95%CI: 0.23 - 0.74), whereas rs12882299 CT+CC genotype increased significantly in the chronic HBV infection compared to the healthy subjects (OR = 1.97, 95%CI: 1.27 - 3.07). By using clearance subjects as control group, we found that rs12882299 CT + CC genotype increased the risk of HBV infection (OR = 1.71, 95%CI: 1.13 - 2.58) (Table 4).

Table 4. Associations of CIITA and NTCP Polymorphisms with HBV Infection
SNPHealthy SubjectsClearance SubjectsChronic HBV Infection SubjectsPa OR (95%CI)Pb OR (95%CI)
rs7404672
CC98121171
CT56611190.6200.405
TT1617151.11 (0.74 - 1.64)1.17 (0.80 - 1.71)
rs9302456
CC155171260
CT1327440.0150.356
TT2112.24 (1.17 - 4.29)1.28 (0.75 - 2.19)
rs3087456
GG144164250
AG2527540.2820.471
AA1811.34 (0.78 - 2.28)1.19(0.73 - 1.94)
rs12928665
GG7180114
AG69871440.2500.469
AA3032471.26 (0.84 - 1.88)1.51(0.78 - 1.68)
rs12932187
CC6272107
GC74931480.9970.843
GG3434500.99 (0.66 - 1.50)0.96 (0.65 - 1.41)
rs4774
GG126152229
GC4146680.9100.876
CC3180.97 (0.62 - 1.52)1.03 (0.67 - 1.59)
rs2296651
GG1391712780.0030.168
AG1928270.41 (0.23 - 0.74)0.67 (0.37 - 1.19)
AA1200
rs11622925
CC1301552220.3610.252
CT3837761.23 (0.79 - 1.94)1.29 (0.84 - 1.99)
TT277
rs4646287
CC1381652510.8260.929
CT2930510.95(0.58 - 1.57)1.02(0.63 - 1.67)
TT343
rs12882299
TT5665710.0030.011
CT75981741.97 (1.27 - 3.07)1.71 (1.13 - 2.58)
CC393660

aHealthy subjects versus chronic HBV infection subjects.

bClearance subjects versus chronic HBV infection subjects.

4.3. CIITA and NTCP Loci Polymorphisms with HBV Progression

We were interested in the possible association between the polymorphisms of CIITA and NTCP genes and the progression of chronic hepatitis B. Therefore, we further analyzed the differences in 10 SNPs genotype distributions by using CHB as control group. As can be seen, among HCC group, LC group, and CHB group, the distribution of CIITA and NTCP genotype frequencies showed no significant difference in the dominant genetic model (Table 5).

Table 5. Associations of CIITA and NTCP Polymorphisms with HBV Progression
SNPCHBLCHCCPa OR (95%CI)Pb OR (95%CI)
rs7404672
CC894339
CT7321250.5200.752
TT7440.78 (0.36 - 1.66)1.14 (0.50 - 2.58)
rs9302456
CC1435661
CT261170.0910.515
TT0102.52 (0.86 - 7.37)1.57 (0.40 - 6.21)
rs3087456
GG1405456
AG2913120.1600.412
AA0102.04 (0.75 - 5.56)1.63 (0.50 - 5.27)
rs12928665
GG612726
AG8528310.5720.876
AA2313110.80 (0.37 - 1.72)1.06 (0.46 - 2.46)
rs12932187
CC572327
GC8733280.6700.338
GG2512130.83 (0.37 - 1.88)0.65 (0.27 - 1.55)
rs4774
GG1265152
GC3814160.9970.758
CC5301.00 (0.43 - 2.31)1.15 (0.46 - 2.86)
rs2296651
GG15165620.5070.717
AG18360.54 (0.09 - 3.33)1.33 (0.28 - 6.21)
AA000
rs11622925
CC12350490.8810.069
CT4216181.07 (0.43 - 2.65)2.41 (0.93 - 6.22)
TT421
rs4646287
CC14155550.6690.517
CT2712121.23 (0.47 - 3.23)0.71 (0.24 - 2.03)
TT111
rs12882299
TT3519170.1370.498
CT10235370.52 (0.22 - 1.23)0.71 (0.27 - 1.90)
CC321414

aCHB versus LC.

bCHB versus HCC.

5. Discussion

Recently, genome-wide association studies in Japanese and Korean populations have shown that gene variants at HLA-DP and HLA-DQ are associated with chronic HBV infection (4, 5, 13), and the result has been verified in many studies (14-16). CIITA plays a pivotal role in the immune response by controlling HLA-II gene expression, and it is considered to be an important candidate gene in immune diseases (17). In 2007, Zhang et al. (18) indicated that CIITA gene promoter IV upstream -1350C/T (rs12928665) and -944G/C (rs12932187) were associated with chronic HBV infection. It is likely that due to differences in geographic distribution of study populations, our study was not consistent with the previous study. Swanberg et al. (19) reported that CIITA gene promoter III upstream -168A/G (rs3087456) was associated with increased susceptibility to rheumatoid arthritis and multiple sclerosis. The explanation was that A→G substitution of promoter III of CIITA gene was associated with lower induction of HLA-II gene. The rs4774 (Gly500Ala) located in exon 11 has been confirmed by many studies to be associated with rheumatoid arthritis and multiple sclerosis (20, 21). However, our study did not identify the association of rs3087456 and rs4774 with chronic HBV infection.

Human NTCP protein includes 349 amino acids and contains a putative seven- or nine-transmembrane domain with a predicted topology of N-termianl extracellular and C-terminal intracellular ends (22). Several SNPs that alter the transporter activity of NTCP have been reported (23, 24). Yan et al. (25) found, in subsequent studies, that a homozygotic mutation of rs2296651 (p.Ser267Phe) on the fourth exon 4 of the NTCP gene can significantly reduce its activity. A mutation in p.Ser267Phe reduced bile acid absorption and also affected its combination with the HBV Pre-S1 protein, leading to the reduced efficiency of HBV infection. The efficiency of HBV infection and transport of taurocholic acid increased by 70% in HepG2 cells transinfected with the wild genotype and p.Ser267Phe mutant genotype at 1:1 compared to HepG2 cells transinfected with the mutant genotype. It is reasonable to speculate that heterozygous individuals may also be susceptible to HBV infection. Because our research only identified the rs2296651 AA genotype in healthy subjects, and there was a significant difference only between healthy subjects and the chronic HBV infection group, our results also confirmed the speculation. It should be noted that the p.Ser267Phe variant is located beyond the amino acids 157 to 165 of NTCP, which have been demonstrated to be critical for HBV entry into the hepatocyte (26). Possibly the p.Ser267Phe mutation changed the topology of NTCP and impaired HBV entry into the hepatocyte.

Peng et al. (27) and Su et al. (28) had published NTCP gene polymorphisms about chronic HBV infection when our manuscript was preparing. Peng et al. (27) found that A allele of rs2296651 decreased the risk of chronic HBV infection, which was consistent with our findings. We found that the frequency of the A allele of rs2296651 in the healthy subjects of this study (12.6%) is higher than the previously reported frequency in Koreans (3.1%) (24) and Chinese-Americans (7.5%) (23). The frequency is also higher than that previously documented in Chinese (4.7%) (25). These may reflect the differences of the ethnic and geographic distributions of this variant. Su et al. (28) found that rs7154439 AA genotype increased viral clearance because rs7154439 and rs12882299 both are located in the 5’ flanking region of NTCP gene and showed a weak LD (R2 = 0.255). Our results show that rs12882299 increased the risk of chronic HBV infection. We further found that rs7154439 and rs11622925 showed a strong LD (R2 = 0.884). However, our study did not identify rs11622925 associated with chronic HBV infection.

In conclusion, our study indicated that rs2296651 was negatively correlated with chronic HBV infection, and rs12882299 and rs9302456 could increase the risk of chronic HBV infection. However, considering the poor repeatability of the existing studies, a large sample size, particularly in multicenter research, is needed to verify the correlation between CIITA and NTCP gene variants and chronic HBV infection.

Acknowledgements

Footnote

References

  • 1.

    Ott JJ, Stevens GA, Groeger J, Wiersma ST. Global epidemiology of hepatitis B virus infection: new estimates of age-specific HBsAg seroprevalence and endemicity. Vaccine. 2012; 30(12) : 2212 -9 [DOI][PubMed]

  • 2.

    Wang L, Wu XP, Zhang W, Zhu DH, Wang Y, Li YP, et al. Evaluation of genetic susceptibility loci for chronic hepatitis B in Chinese: two independent case-control studies. PLoS One. 2011; 6(3)[DOI][PubMed]

  • 3.

    Wang FS. Current status and prospects of studies on human genetic alleles associated with hepatitis B virus infection. World J Gastroenterol. 2003; 9(4) : 641 -4 [DOI][PubMed]

  • 4.

    Kamatani Y, Wattanapokayakit S, Ochi H, Kawaguchi T, Takahashi A, Hosono N, et al. A genome-wide association study identifies variants in the HLA-DP locus associated with chronic hepatitis B in Asians. Nat Genet. 2009; 41(5) : 591 -5 [DOI][PubMed]

  • 5.

    Nishida N, Sawai H, Matsuura K, Sugiyama M, Ahn SH, Park JY, et al. Genome-wide association study confirming association of HLA-DP with protection against chronic hepatitis B and viral clearance in Japanese and Korean. PLoS One. 2012; 7(6)[DOI][PubMed]

  • 6.

    Hu Z, Liu Y, Zhai X, Dai J, Jin G, Wang L, et al. New loci associated with chronic hepatitis B virus infection in Han Chinese. Nat Genet. 2013; 45(12) : 1499 -503 [DOI][PubMed]

  • 7.

    Ting JP, Trowsdale J. Genetic control of MHC class II expression. Cell. 2002; 109 Suppl : S21 -33 [DOI][PubMed]

  • 8.

    Glebe D, Urban S. Viral and cellular determinants involved in hepadnaviral entry. World J Gastroenterol. 2007; 13(1) : 22 -38 [DOI][PubMed]

  • 9.

    Yan H, Zhong G, Xu G, He W, Jing Z, Gao Z, et al. Sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis B and D virus. Elife. 2012; 3[DOI][PubMed]

  • 10.

    Chinese Society of H, Chinese Society of Infectious Diseases CMA. [The guideline of prevention and treatment for chronic hepatitis B (2010 version)]. Zhonghua Liu Xing Bing Xue Za Zhi. 2011; 32(4) : 405 -15 [PubMed]

  • 11.

    Qiu B, Wang X, Zhang P, Shi C, Zhang J, Qiu W, et al. Association of TNF-alpha promoter polymorphisms with the outcome of persistent HBV infection in a northeast Chinese Han population. Acta Biochim Biophys Sin (Shanghai). 2012; 44(8) : 712 -8 [DOI][PubMed]

  • 12.

    Shen W, Du J, Wang B, Zeng Q. Analysis of nitric oxide synthase gene polymorphisms in neonatal respiratory distress syndrome among the Chinese Han population. Ital J Pediatr. 2014; 40(1) : 27 [DOI][PubMed]

  • 13.

    Mbarek H, Ochi H, Urabe Y, Kumar V, Kubo M, Hosono N, et al. A genome-wide association study of chronic hepatitis B identified novel risk locus in a Japanese population. Hum Mol Genet. 2011; 20(19) : 3884 -92 [DOI][PubMed]

  • 14.

    Hu L, Zhai X, Liu J, Chu M, Pan S, Jiang J, et al. Genetic variants in human leukocyte antigen/DP-DQ influence both hepatitis B virus clearance and hepatocellular carcinoma development. Hepatology. 2012; 55(5) : 1426 -31 [DOI][PubMed]

  • 15.

    Li J, Yang D, He Y, Wang M, Wen Z, Liu L, et al. Associations of HLA-DP variants with hepatitis B virus infection in southern and northern Han Chinese populations: a multicenter case-control study. PLoS One. 2011; 6(8)[DOI][PubMed]

  • 16.

    Kim YJ, Kim HY, Lee JH, Yu SJ, Yoon JH, Lee HS, et al. A genome-wide association study identified new variants associated with the risk of chronic hepatitis B. Hum Mol Genet. 2013; 22(20) : 4233 -8 [DOI][PubMed]

  • 17.

    Rasmussen HB, Kelly MA, Clausen J. Genetic susceptibility to multiple sclerosis: detection of polymorphic nucleotides and an intron in the 3' untranslated region of the major histocompatibility complex class II transactivator gene. Hum Immunol. 2001; 62(4) : 371 -7 [DOI][PubMed]

  • 18.

    Zhang X, Hong X, Deng G, Bai X. Single nucleotide polymorphisms and functional analysis of class II transactivator (CIITA) promoter IV in persistent HBV infection. J Clin Virol. 2007; 40(3) : 197 -201 [DOI][PubMed]

  • 19.

    Swanberg M, Lidman O, Padyukov L, Eriksson P, Akesson E, Jagodic M, et al. MHC2TA is associated with differential MHC molecule expression and susceptibility to rheumatoid arthritis, multiple sclerosis and myocardial infarction. Nat Genet. 2005; 37(5) : 486 -94 [DOI][PubMed]

  • 20.

    Martinez A, Sanchez-Lopez M, Varade J, Mas A, Martin MC, de Las Heras V, et al. Role of the MHC2TA gene in autoimmune diseases. Ann Rheum Dis. 2007; 66(3) : 325 -9 [DOI][PubMed]

  • 21.

    Bronson PG, Caillier S, Ramsay PP, McCauley JL, Zuvich RL, De Jager PL, et al. CIITA variation in the presence of HLA-DRB1*1501 increases risk for multiple sclerosis. Hum Mol Genet. 2010; 19(11) : 2331 -40 [DOI][PubMed]

  • 22.

    Watashi K, Urban S, Li W, Wakita T. NTCP and beyond: opening the door to unveil hepatitis B virus entry. Int J Mol Sci. 2014; 15(2) : 2892 -905 [DOI][PubMed]

  • 23.

    Ho RH, Leake BF, Roberts RL, Lee W, Kim RB. Ethnicity-dependent polymorphism in Na+-taurocholate cotransporting polypeptide (SLC10A1) reveals a domain critical for bile acid substrate recognition. J Biol Chem. 2004; 279(8) : 7213 -22 [DOI][PubMed]

  • 24.

    Pan W, Song IS, Shin HJ, Kim MH, Choi YL, Lim SJ, et al. Genetic polymorphisms in Na+-taurocholate co-transporting polypeptide (NTCP) and ileal apical sodium-dependent bile acid transporter (ASBT) and ethnic comparisons of functional variants of NTCP among Asian populations. Xenobiotica. 2011; 41(6) : 501 -10 [DOI][PubMed]

  • 25.

    Yan H, Peng B, Liu Y, Xu G, He W, Ren B, et al. Viral entry of hepatitis B and D viruses and bile salts transportation share common molecular determinants on sodium taurocholate cotransporting polypeptide. J Virol. 2014; 88(6) : 3273 -84 [DOI][PubMed]

  • 26.

    Yan H, Peng B, He W, Zhong G, Qi Y, Ren B, et al. Molecular determinants of hepatitis B and D virus entry restriction in mouse sodium taurocholate cotransporting polypeptide. J Virol. 2013; 87(14) : 7977 -91 [DOI][PubMed]

  • 27.

    Peng L, Zhao Q, Li Q, Li M, Li C, Xu T, et al. The p.Ser267Phe variant in SLC10A1 is associated with resistance to chronic hepatitis B. Hepatology. 2015; 61(4) : 1256 -60 [DOI][PubMed]

  • 28.

    Su Z, Li Y, Liao Y, Cai B, Chen J, Zhang J, et al. Association of the gene polymorphisms in sodium taurocholate cotransporting polypeptide with the outcomes of hepatitis B infection in Chinese Han population. Infect Genet Evol. 2014; 27 : 77 -82 [DOI][PubMed]

  • Copyright © 2017, Kowsar Corp. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.
    COMMENTS

    LEAVE A COMMENT HERE: