The Association of V427M Missense Mutation of the PRODH Gene with Schizophrenia in the Iranian Patients

AUTHORS

Seyedeh Sara Karimian 1 , Mohammad Taghi Akbari ORCID 2 , *

1 Department of Biology, Sciences and Research Branch, Islamic Azad University, Tehran, Iran

2 Department of Medical Genetics, Faculty of Medical Sciences, Tarbiat Modarres University, Tehran, Iran

How to Cite: Karimian S S, Akbari M T. The Association of V427M Missense Mutation of the PRODH Gene with Schizophrenia in the Iranian Patients, J Human Gen Genom. 2018 ; 2(2):e83501. doi: 10.5812/jhgg.83501.

ARTICLE INFORMATION

Journal of Human Genetics and Genomics: 2 (2); e83501
Published Online: December 19, 2018
Article Type: Research Article
Received: August 20, 2018
Accepted: November 3, 2018
Crossmark
Crossmark
CHECKING
READ FULL TEXT

Abstract

Background: PRODH is one of the genes that exists in 22q11.2 location and encodes the prolin oxidase enzyme (POX) in the mitochondrial inner membrane and is expressed in the liver, kidney and brain. The importance of the accompaniment of the PRODH gene’s polymorphisms and mutations in increasing the risk of getting afflicted with schizophrenia has been proven in previous Linkage and Association studies. Proline dehydrogenase enzyme (POX) accelerates the converting of prolin into glutamate. Decreased enzyme causes hyperprolinemia resulting in increased proline and decreased glutamate. The activity of NMDA and AMPA receptors decrease and low activation of these receptors cause negative symptoms of schizophrenia disorder. V427M mutation in PRODH has been proven to decrease pox enzyme activity and is associated with schizophrenia disorder.

Objectives: In this project the rs2238731 variant in the PRODH gene was genotyped in 95 schizophrenic patients whose diseases are psychiatrically confirmed and also in 120 healthy people without any history of schizophrenia and bipolarity in their pedigree. For this purpose, their peripheral blood was taken.

Methods: In this study, the PCR-RFLP approach has been adopted in order to identify this variant. The SPSS 24.0 software has been used in order to statistically analyze the association of mutant variants and normal variants among the two groups afflicted with the disease and non-afflicted with the disease. The goal of this study was to shed light over the accompaniment of the rs2238731 variant in the PRODH gene with the risk of getting afflicted with schizophrenia among the Iranian patients.

Results: According to our result, there is no association between V427M missense mutation and schizophrenia disorder in Iranian patients. So the V427M missense mutation could not be regarded as co-related with increasing risk of schizophrenia in Iranian patients.

1. Background

One of the strongest risk factors for schizophrenia is the deletion in 22q11 (1). More than a third of patients with 22q11 syndrome, known as Digeorge syndrome or Velocardiofacial, are afflicted with schizophrenia or schizoaffective (2). In addition, while the prevalence of 22q11 deletion in the total population is 1 in 4000, its frequency is almost 1% among adult SCZ patients (3). The deletion of 22q11 has been proposed as a genetic cause of schizophrenia, so the genes that are present in this area tends to make people susceptible to the disease. One of the commonly eliminated genes in 22q11 is PRODH which encodes proline dehydrogenase. The PRODH gene contains fourteen exons repeat that are located in a repeat sequence with a low copy and widely expressed in the brain and the rest tissues (4). This gene has a wide range of SNP. This high rate of polymorphisms can be the result of the presence of telomeric unprocessed pseudo gene 4 GB, that is located in chromosome 22 and stores SNPs as a treasury, and can transfer Single Nucleotide Polymorphisms (SNPs) to the PRODH by mechanism of displacement. This mechanism is thought to explain the frequency of polymorphisms in this gene (5). At least sixteen missense mutations have been identified in studies of hyperprolinemia (HPI) and 5SZ. Ten mutations were as frequency of polymorphic (5). The gene encodes a mitochondrial enzyme that catalyzes the conversion of proline to glutamate, which catalyzes the first stage in proline catabolism, proline modulates neurotransmitter glutamine and affects the NMDA receptor, as well as known as proline oxidase (POX), a mitochondrial suppressor tumor (6), which inhibits proliferation and induces apoptosis. Knockout mice in PRODH, dopaminergic signaling has been increased and neurotransmitter transfer has been altered, and the learning nerve base of memory is impaired. These changes occur in the frontal cortex during the formation of the synapse (7). There is a lot of evidence suggesting the important role of PRODH in SZ, this evidence includes:

1. This gene is located in the chromosome 22q11.2, and removal in this chromosome is one of the strongest risk factors for schizophrenia.

2. Missense mutations in PRODH have been reported in SZ patients (5).

3. Correlation of schizoaffective disorder and Moderate hyperprolinemia had been previously identified. Hyperprolinemia is an autosomal recessive genetic disorder that occurs due to defective enzyme of Pox (8).

4. The gene is widely expressed in the brain.

5. Mice with defect in PRODH shows increasing proline levels in plasma and in the brain shows local reductions in glutamate and gamma-amino butyric acid (GABA) (9, 10). 6-PRODH enzyme plays a role in the conversion of proline to glutamate, which is important for the signal transduction in neurons and for synaptic plasticity, and it seems that it is not regulated in schizophrenia (11).

PRODH, along with its role in catabolism, is also known as a key enzyme in controlling homeostasis, energy supply and the potential for inter-cellular chemical transfer and reactive oxygen production (12). It is shown that functional polymorphisms in PRODH is associated with SZ risk and correlate with changes in the Prefrontal- striatal circuit of the brain and working memory and the cognitive gating of the brain (13). According to the results of control samples, it has been shown that non-functional SNPs do not have any significant effect on the brain’s phenotype. Also, the hypothesis that the alleles should also be present in the healthy siblings of the sick people was investigated. Healthy siblings have SNPs that reduce the activity of POX enzymes (13). Defective Glutamargic neurotransmitter is widely involved in the SZ pathology (13, 14). The glutamargic defect, specifically, the NMDA receptor, plays a role in SZ. The NMDA antagonist injection creates cognitive impairment and SZ symptoms in healthy subjects and changes in the transfer of dopaminergic neurons. The knockout mice in PRODH correlates with the increase of the dopaminergic signaling pathway, also changes the transfer of glutamatergic neurotransmitter transfer and reduces the long-term potential of the learning and memory neural base (10). As a result, SNPs that reduce the activity of POX enzymes produce negative SZ symptoms. Changes in the efficiency of the POX protein can cause significant changes in brain circuits, which results in disruptions in the genotype, such as memory and attention.

2. Methods

2.1. Patients and Controls

In order to genotype the selected SNP, 95 SZ patients were recruited and five mL of blood samples were taken from all participants in EDTA tubes and were immediately processed for DNA extraction. Based on the two approaches of Diagnostic and Statistical Manual of Mental Disorders (DSM-5) symbolism and the Positive and Negative Syndrome Scale (PANSS), patients from Imam Hussein Hospital and Schizophrenic Patient Support institution (AHEBBA) - Both named places located in Tehran- were clinically diagnosed with SZ by an expert psychiatrist. Letter of consent was obtained from all of the participants, and this investigation was carried out in line with the Declaration of Helsinki. This study was approved by the Medical Ethics Committee of, Science and Research Branch, Islamic Azad University, Tehran, Iran. In this study, we also included 120 healthy control people without any psychological history in their families and demographically matched them with SZ patients.

2.2. DNA Extraction and Genotyping

Genomic DNA samples were extracted from whole blood using MagCore HF16 Automatic Nucleic Acid Extractor system (RBC Bioscience Corp, Taiwan) with MagCore blood Genomic DNA Extraction Kit (RBC Bioscience Corp, Taiwan) and were stored in -20°C for future analysis. The quality and quantity of the extracted DNA were respectively determined by nanodrop and 1% agarose gel electrophoresis. Primers for PCR-RFLP and sequencing methods, were designed using gene runner software and www.SNPer.com. In this study, SNP rs2238731, was identified through the PCR-RFLP method. After the proliferation of approximately 100 ng of genomic DNA, the PCR products were digested using Hin1II (NIaIII), restriction enzyme according to the manufacturer’s instructions. We ran digested samples on 12% polyacrylamide gel and used silver nitrate to spot the DNAs. In this study and in order to make sure of the results drawn based on the method PCR-RFLP, one third of the samples were sequenced at random using the applied biosystems (AB), (3130 Genetic Analyzer). The genotyping results drawn from the PCR-RFLP method of sequencing and RFLP-PCR were compared for validation. There was complete concordance between sequencing and RFLP-PCR methods for the SNP. The utilized primers and required restriction enzyme were listed in Table 1.

Table 1. Primers Used in This Study for PCR-RFLP and Sequencing Methods
GeneSNPPrimer SequencesSequencing Method
PRODHrs2238731F: GGACAGAGGTTGGAGGCCC315 bp61Hin1II (NIaIII)
R: GTTGATGGGGTCCTCATAGCC

Abbreviation: SNP, single nucleotide polymorphism.

2.3. Statistical Analysis

Chi-Square test was used to evaluate if our data for each SNP is in Hardy-Weinberg equilibrium (HWE) (15). The statistical package for the social sciences version 24 (SPSS, version 24; SPSS Inc., Chicago, IL) was used to analyze the results. The Kolmogrov-Smirnov test was used to assess if the data were normally distributed. To assess the association of our selected SNP with SZ, the allelic and genotypic frequencies were compared via non-parametric Pearson χ2 test for cases and controls with a Bonferroni-corrected statistical significance level. Major allele homozygous, heterozygous and minor allele homozygous groups were determined and OR (odds ratio) and 95% CI (confidence interval) were calculated for each genotype. P value ≤ 0.05 was considered significant.

3. Results

3.1. SZ Patients and Control Subjects

The characteristics of the SZ patients and healthy controls are presented in Table 2.

Table 2. Characteristic of Cases and Control
DiagnosisGender, M/FAgeaPANSSa
SCZ (n = 95)65/3032 ± 12.1880 ± 10.0039
Control (n = 120)78/4235 ± 14.14-

aValues are expressed as mean ±SD.

3.2. Allelic Association

In the Iranian patients group, allele T showed no association in rs2238731 with SZ. The allelic frequency of rs2238731 in the Non-schizophrenic and schizophrenic samples is 0.98/0.01 (C/T). For the allelic frequency of rs2238731, the odds ratio equals 0.81, with confidence interval, 0.05 - 13.02. Pearson χ2 test for the allelic frequency of rs2238731 equals 0.022 and P value equals 0.881 and is not significant (P > 0.05) (Table 3).

Table 3. The Summary Results of Associated SNP of, PRODH
GeneChrSNPA1/A2Common AlleleP ValueOR (95% CI)Pearson χ2
PRODH22rs2238731T/CC0.8810.81 (0.05 - 13.02)0.022

3.3. Hardy-Weinberg Equilibrium

The genotypic distribution of the SNP rs2238731 that was addressed in this study in the two groups of case and control was in hardy Weinberg equilibrium (Table 4).

Table 4. Genotypic and Allelic Distributions for Controls and Schizophrenia Casesa
NGenotype Counts (Frequency)Allele Counts (Frequency)χ2 (P Value)
Polymorphism, rs2238731CCCTTTCT
SCZ9593 (97.9)2 (2.1)0 (0)0.980.010.01 (P > 0.05)
Controls117114 (97.5)2 (1.7)0 (0)0.980.010.01 (P > 0.05)

aChi-square’s exact P values are shown for allelic distribution between case-controls.

χ2 was calculated by Hardy-Weinberg equilibrium testing (15) (Table 4).

4. Discussion

In fact, the PRODH gene is the most important gene known in relation with SZ, PRODH codes the proline dehydrogenase protein (POX), which catalyzes proline into glutamate. Any change in the efficiency of the enzyme proline dehydrogenase affects the amount of glutamate and Glutamatergic pathway. The role of the PRODH gene in schizophrenia in different populations has been reported repeatedly (16). SNP; rs2238731 is located in exon 12 of the PRODH gene. SNP, rs2238731 (V427M) is a functional missense mutation. This SNP is located and translated in the exon region and converts amine acid valin into amine acid methionine.

In a study conducted at the Harvard University and John Hopkins in the American population, it has been reported that V427M has reduced the activity of POX enzyme to 30% - 70% in people with schizophrenia. Reducing POX enzyme increases proline and decreases glutamate, followed by it, changes in Glutamatergic efficiency and NMDA receptor efficiency. Decreasing NMDA efficacy is raised in creating negative SZ symptoms (10, 17-19). The hypothesis of glutamargic pathway involvement in SZ disorder was raised many years ago. There have been many reports from 1949 that some patients with SZ have been treated with glutamic acid (20). Studies of expression of NMDA receptor in post mortem samples have reported a decrease in NMDAR1 subunit density in the Superior frontal cortex and superior temporal cortex (21). It seems that abnormality in NMDA receptors in SZ disorder is due to inappropriate density of NMDA receptors (22). This abnormality can be the result of changes in Glutamate receptor trafficking molecules (23). The role of glutamate in SZ physiology is also confirmed with genetic findings. The GRIN2A gene that encodes NMDA receptor subunit is correlated with SZ. Also, SRR, which plays a key role in the activation of NMDA receptors, has also been correlated with SZ (24). The injection of NMDA receptor antagonists, such as phencyclidine (PCP), discipline (MK-801), and ketamine, produce a psychological effects that is very similar to the positive and negative symptoms of SZ (25-27). In another study on the Brazilian population, the relationship between SNP, V427M and cortical cortex thickness was reported, which confirms the role of SNP, rs2238731 in the shape and size of the brain. Cortical cortex of brain of patients with GA genotype has a lower thickness than patients with GG genotype (12), which indicates the important role of this variant in modifying proline dehydrogenase function.

In this study, the correlation between V427M (rs2238731) and SZ was evaluated. No association was found between this variant and schizophrenia and the allele frequency of this variant in both healthy and patient groups did not show any significant difference (P = 0.881, OR = 0.81, CI = 0.05 - 13.02). The PRODH gene in relation to SZ has been studied in Iran repeatedly, the association between variants of 1945 T > C, 757 C > T, 1766 A > G and 1852 G > A in the PRODH and SZ gene, has been studied, and significant results have been obtained (28-30). Despite the role of SNP, rs2238731 in the schizophrenia, there was no association between SNP, rs2238731 and schizophrenia in Iranian subjects. The frequency of C and T alleles in SNP rs2238731 did not show a significant difference between two healthy and patient groups (P = 0.881) and SNP rs2238731 in Iranian subjects is in Hardy Weinberg equilibrium (HWE; P > 0.05). In this study, there were 4 GA genotypes in general, 2 of them were SZ and 2 were healthy, and the frequency of alleles A and G did not show significant difference in healthy and patient groups. The frequency of allele-minor A of rs2238731 in the Iranian population is 0.01. And the frequency of allele A, in the American population is 0.20 and has been reported as allele predisposing schizophrenia. A study conducted in 2014 suggested that G allele in SNP rs2238731, possibly by altering brain enzyme activity, should be a protective and preventing factor in schizophrenia (12).

The limitations of this research are small sample size and a small number of the polymorphisms that were addressed in this study. The sample size in this study is too small for us to come to a definite conclusion with regard to the no association between rs2238731 in the gene PRODH and SZ. Therefore, further studies are required in order to confirm the results of this study. Also, in order to confirm the association between the PRODH gene and its polymorphisms and SZ in the Iranian population more SNP’s in this gene should be analyzed.

4.1. Conclusion

There was no association between allele A in SNP rs2238731 and SZ in Iranian subjects. Therefore, V427M, in spite of its role in the activity of POX enzyme reported in other populations, is not association with SZ in Iranian subjects and may decrease the activity of POX enzyme in Iranian people due to the involvement of other SNPs in the PRODH gene.

Acknowledgements

Footnotes

References

  • 1.

    Levinson DF, Duan J, Oh S, Wang K, Sanders AR, Shi J, et al. Copy number variants in schizophrenia: Confirmation of five previous findings and new evidence for 3q29 microdeletions and VIPR2 duplications. Am J Psychiatry. 2011;168(3):302-16. doi: 10.1176/appi.ajp.2010.10060876. [PubMed: 21285140]. [PubMed Central: PMC4441324].

  • 2.

    Pulver AE, Nestadt G, Goldberg R, Shprintzen RJ, Lamacz M, Wolyniec PS, et al. Psychotic illness in patients diagnosed with velo-cardio-facial syndrome and their relatives. J Nerv Ment Dis. 1994;182(8):476-8. doi: 10.1097/00005053-199408000-00010. [PubMed: 8040660].

  • 3.

    Christofolini DM, Bellucco FT, Ota VK, Belangero SI, Cernach MC, Gadelha A, et al. Assessment of 22q11.2 copy number variations in a sample of Brazilian schizophrenia patients. Schizophr Res. 2011;132(1):99-100. doi: 10.1016/j.schres.2011.07.007. [PubMed: 21813265].

  • 4.

    Shaikh TH, Kurahashi H, Saitta SC, O'Hare AM, Hu P, Roe BA, et al. Chromosome 22-specific low copy repeats and the 22q11.2 deletion syndrome: Genomic organization and deletion endpoint analysis. Hum Mol Genet. 2000;9(4):489-501. doi: 10.1093/hmg/9.4.489. [PubMed: 10699172].

  • 5.

    Bender HU, Almashanu S, Steel G, Hu CA, Lin WW, Willis A, et al. Functional consequences of PRODH missense mutations. Am J Hum Genet. 2005;76(3):409-20. doi: 10.1086/428142. [PubMed: 15662599]. [PubMed Central: PMC1196393].

  • 6.

    Liu W, Phang JM. Proline dehydrogenase (oxidase), a mitochondrial tumor suppressor, and autophagy under the hypoxia microenvironment. Autophagy. 2012;8(9):1407-9. doi: 10.4161/auto.21152. [PubMed: 22885468]. [PubMed Central: PMC3442893].

  • 7.

    Liu H, Heath SC, Sobin C, Roos JL, Galke BL, Blundell ML, et al. Genetic variation at the 22q11 PRODH2/DGCR6 locus presents an unusual pattern and increases susceptibility to schizophrenia. Proc Natl Acad Sci U S A. 2002;99(6):3717-22. doi: 10.1073/pnas.042700699. [PubMed: 11891283]. [PubMed Central: PMC122590].

  • 8.

    Jacquet H, Demily C, Houy E, Hecketsweiler B, Bou J, Raux G, et al. Hyperprolinemia is a risk factor for schizoaffective disorder. Mol Psychiatry. 2005;10(5):479-85. doi: 10.1038/sj.mp.4001597. [PubMed: 15494707].

  • 9.

    Gogos JA, Santha M, Takacs Z, Beck KD, Luine V, Lucas LR, et al. The gene encoding proline dehydrogenase modulates sensorimotor gating in mice. Nat Genet. 1999;21(4):434-9. doi: 10.1038/7777. [PubMed: 10192398].

  • 10.

    Paterlini M, Zakharenko SS, Lai WS, Qin J, Zhang H, Mukai J, et al. Transcriptional and behavioral interaction between 22q11.2 orthologs modulates schizophrenia-related phenotypes in mice. Nat Neurosci. 2005;8(11):1586-94. doi: 10.1038/nn1562. [PubMed: 16234811].

  • 11.

    Sawa A. Cortical development and glutamatergic dysregulation in schizophrenia. Biol Psychiatry. 2009;66(6):530-2. doi: 10.1016/j.biopsych.2009.07.016. [PubMed: 19712774]. [PubMed Central: PMC4113958].

  • 12.

    Ota VK, Bellucco FT, Gadelha A, Santoro ML, Noto C, Christofolini DM, et al. PRODH polymorphisms, cortical volumes and thickness in schizophrenia. PLoS One. 2014;9(2). e87686. doi: 10.1371/journal.pone.0087686. [PubMed: 24498354]. [PubMed Central: PMC3912045].

  • 13.

    Kempf L, Nicodemus KK, Kolachana B, Vakkalanka R, Verchinski BA, Egan MF, et al. Functional polymorphisms in PRODH are associated with risk and protection for schizophrenia and fronto-striatal structure and function. PLoS Genet. 2008;4(11). e1000252. doi: 10.1371/journal.pgen.1000252. [PubMed: 18989458]. [PubMed Central: PMC2573019].

  • 14.

    Bressan RA, Pilowsky LS. [Glutamatergic hypothesis of schizophrenia]. Braz J Psychiatr. 2003;25(3):177-83. Portuguese. doi: 10.1590/S1516-44462003000300011. [PubMed: 12975693].

  • 15.

    Rodriguez S, Gaunt TR, Day IN. Hardy-Weinberg equilibrium testing of biological ascertainment for Mendelian randomization studies. Am J Epidemiol. 2009;169(4):505-14. doi: 10.1093/aje/kwn359. [PubMed: 19126586]. [PubMed Central: PMC2640163].

  • 16.

    Bassett AS, Chow EW. Schizophrenia and 22q11. 2 deletion syndrome. Curr Psychiatry Rep. 2008;10(2):148. doi: 10.1007/s11920-008-0026-1.

  • 17.

    du Bois TM, Huang XF. Early brain development disruption from NMDA receptor hypofunction: Relevance to schizophrenia. Brain Res Rev. 2007;53(2):260-70. doi: 10.1016/j.brainresrev.2006.09.001. [PubMed: 17014910].

  • 18.

    Farber NB, Kim SH, Dikranian K, Jiang XP, Heinkel C. Receptor mechanisms and circuitry underlying NMDA antagonist neurotoxicity. Mol Psychiatry. 2002;7(1):32-43. doi: 10.1038/sj/mp/4000912. [PubMed: 11803444].

  • 19.

    Theberge J, Bartha R, Drost DJ, Menon RS, Malla A, Takhar J, et al. Glutamate and glutamine measured with 4.0 T proton MRS in never-treated patients with schizophrenia and healthy volunteers. Am J Psychiatry. 2002;159(11):1944-6. doi: 10.1176/appi.ajp.159.11.1944. [PubMed: 12411236].

  • 20.

    Kitzinger H, Arnold DG; et al. A preliminary study of the effects of glutamic acid on catatonic schizophrenics. Rorschach Res Exch J Proj Tech. 1949;13(2):210-8. doi: 10.1080/10683402.1949.10381459. [PubMed: 18137723].

  • 21.

    Sokolov BP. Expression of NMDAR1, GluR1, GluR7, and KA1 glutamate receptor mRNAs is decreased in frontal cortex of "neuroleptic-free" schizophrenics: Evidence on reversible up-regulation by typical neuroleptics. J Neurochem. 1998;71(6):2454-64. doi: 10.1046/j.1471-4159.1998.71062454.x. [PubMed: 9832144].

  • 22.

    Hammond J, Shan D, Meador-Woodruff J, McCullumsmith R. Evidence of glutamatergic dysfunction in the pathophysiology of schizophrenia. Synaptic stress and pathogenesis of neuropsychiatric disorders. Springer; 2014. p. 265-94.

  • 23.

    Funk AJ, Rumbaugh G, Harotunian V, McCullumsmith RE, Meador-Woodruff JH. Decreased expression of NMDA receptor-associated proteins in frontal cortex of elderly patients with schizophrenia. Neuroreport. 2009;20(11):1019-22. doi: 10.1097/WNR.0b013e32832d30d9. [PubMed: 19483657]. [PubMed Central: PMC3731946].

  • 24.

    Schizophrenia Working Group of the Psychiatric Genomics C. Biological insights from 108 schizophrenia-associated genetic loci. Nature. 2014;511(7510):421-7. doi: 10.1038/nature13595. [PubMed: 25056061]. [PubMed Central: PMC4112379].

  • 25.

    Krystal JH, Karper LP, Seibyl JP, Freeman GK, Delaney R, Bremner JD, et al. Subanesthetic effects of the noncompetitive NMDA antagonist, ketamine, in humans. Psychotomimetic, perceptual, cognitive, and neuroendocrine responses. Arch Gen Psychiatry. 1994;51(3):199-214. doi: 10.1001/archpsyc.1994.03950030035004. [PubMed: 8122957].

  • 26.

    Morgan CJ, Curran HV. Acute and chronic effects of ketamine upon human memory: A review. Psychopharmacology (Berl). 2006;188(4):408-24. doi: 10.1007/s00213-006-0572-3. [PubMed: 17006715].

  • 27.

    Javitt DC. Glutamate and schizophrenia: Phencyclidine, N-methyl-D-aspartate receptors, and dopamine-glutamate interactions. Int Rev Neurobiol. 2007;78:69-108. doi: 10.1016/S0074-7742(06)78003-5. [PubMed: 17349858].

  • 28.

    Rahman Zadeh S, Shahbaz Mohammadi H, Karimipour M, Heidari Keshel S. Investigation of genetic association between PRODH gene and schizophrenia in Iranian population. J Paramed Sci. 2012;3(1):2916.

  • 29.

    Ghasemvand F, Salehi Z, Fakour Y, Omidinia E. Association of 757 C/T polymorphismin PRODH gene with schizophrenia in Iranian population. J Paramed Sci. 2013;4(1).

  • 30.

    Ghasemvand F, Omidinia E, Salehi Z, Rahmanzadeh S. Relationship between polymorphisms in the proline dehydrogenase gene and schizophrenia risk. Genet Mol Res. 2015;14(4):11681-91. doi: 10.4238/2015.October.2.1. [PubMed: 26436492].

  • Copyright © 2018, Journal of Human Genetics and Genomics. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.
    COMMENTS

    LEAVE A COMMENT HERE: