Study of the p.V617F and Exon 12 Mutations in JAK2 Gene Among Iranian Chronic Myeloproliferative Patients

AUTHORS

Sara Khatamianfar 1 , Mohammad Taghi Akbari 2 , * , Shohre Zare Karizi 2 , 3 , Faravareh Khordadpoor Deilamani ORCID 2

1 Department of Biology, Science and Research Branch, Islamic Azad University, Sanandaj, Tehran, Iran

2 Medical Genetics Laboratory, Tehran, Iran

3 Department of Biology, Varamin Pishva Branch, Azad University, Pishva, Iran

How to Cite: Khatamianfar S, Akbari M T, Zare Karizi S, Khordadpoor Deilamani F. Study of the p.V617F and Exon 12 Mutations in JAK2 Gene Among Iranian Chronic Myeloproliferative Patients, J Human Gen Genom. 2019 ; 3(1):e88293. doi: 10.5812/jhgg.88293.

ARTICLE INFORMATION

Journal of Human Genetics and Genomics: 3 (1); e88293
Published Online: December 30, 2019
Article Type: Research Article
Received: December 26, 2018
Accepted: December 14, 2019
Crossmark
Crossmark
CHECKING
READ FULL TEXT

Abstract

Background: Chronic myeloproliferative disorders (CMPD) occur due toclonal proliferation of the single hematopoietic stem cells and result in an increased number of mature and immature cells in the peripheral blood. The mutations in JAK2 gene are identified in large numbers of CMPD patients.

Objectives: The aim of this study was to investigate thep.V617F (c.1849G > T) mutation as well as exon 12 mutations in JAK2 gene in the CMPD patients.

Methods: Philadelphia chromosome negative CMPD patients were recruited for this study. In order to study p.V617F and JAK2 exon 12 mutations in JAK2 gene, FRET probe real-time PCR, allele specific PCR and PCR-direct sequencing were utilized.

Results: JAK2 p.V617F mutation was found in polycythemia vera, Essential thrombocytosis and idiopathic myelofibrosis (67%, 52% and 50% respectively) but not in idiopathic erythrocytosis patients. Also no mutation was found in JAK2 exon 12 of these patients.

Conclusions: Our data regarding p.V617F was in concordance with the previous studies. The absence of any mutation in exon 12 of our patients may be due to extracting DNA from whole blood cells instead of granulocytes, that may impact the detection rate of cycle sequencing method.

1. Background

The myeloproliferative disorders are clonal hematologic malignancies with the feature of abnormal proliferation of myeloid lineages. This group of disorders is divided into two classes. Philadelphia (Ph) chromosome positive (Ph+) patients constitute CML patients and Ph-patients comprise polycythemia vera (PV), essential thrombocytosis (ET) and idiopathic myelofibrosis (IMF) (1-3).

The Janus kinase (JAK) family (including JAK1, JAK2, JAK3, and TYK2 members) is a group of non receptor-tyrosine kinase proteins that have critical role in JAK/STAT signal transduction pathway (2, 4).

Asignificant number of non-CML CMPNs have a somatic gain of function mutation (p.V617F) in the exon 14 of JAK2 gene which is located on chromosome 9p24 (1, 5-8). This single nucleotide mutation happens in the pseudokinase domain of JAK2 (6).

Alsonon-synonymous substitutions, deletions and duplications are identified in JAK2 exon 12 which affect a region adjacent to the start of the pseudo-kinase domain (9).

2. Objectives

In this study we evaluated the prevalence of p.V617F and the mutations of exon 12 of JAK2 gene in non-CML CMPD patients.

3. Methods

One hundred and forty Ph-CMPN patients (76 men (54%) and 64 women (46%)) who were referred by hematologist-oncologists to Tehran Medical Genetics Laboratory were recruited to this study. Philadelphia negative (Ph-) chromosome status was already established by either karyotyping the patients’ bone marrow or analyzing mRNA from their peripheral blood for BCR-ABL translocation. These patients were subdivided into 63 PV, 63 ET and 14 IMF cases. Seventy nine another patients who could not be categorized to either of the aforementioned subgroups were grouped together as idiopathic erythrocytosis (IE) and were subjected to investigation too. Informed written consent was obtained from all patients and their parents for carrying out research on their specimens. The study was approved by the local Ethics Committee.

3.1. DNA Extraction

DNA was extracted from whole blood using salting out method.

3.2. Melting Curve Analysis for Diagnosis of JAK2 p.V617F Mutation

The genotyping assay using fluorescence resonance energy transfer (FRET) probes and melting curve analysis was carried out using the primers and probes designed by Murugesan et al. (1). An amplicon of 177 bp in length was generated using a PCR forward primer, 5’-TTCCTTAGTCTTTCTTTGAAGCA-3’, and a reverse primer, 5’-GTGATCCTGAAACTGAATTTTCT-3’. A sensor probe, 5’-ATGGAGTATGTGTCTGTGG-fuorecein-3’, and an anchor probe, 5’-LCR640-ACGAGAGTAAGTAAAACTACAGGCT-phosphate-3’, were used to perform melting curve analysis (1).

PCR was carried out in Corbett Life Science, Rotor-gene 6000, in a total volume of 20 µL containing 50 ng of genomic DNA. The final reaction contained 200 µmol/L of dNTPs, 4 mmol/L of MgCl2, 0.1 µmol/L of forward primer, 0.5 µmol/L of reverse primer, and 0.2 µmol/L of each of the sensor and anchor probes. The following PCR program was used: initial denaturation at 95°C for 10 minutes; 45 amplification cycles at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; Melting analysis was performed as follows: 95°C for 15 seconds, 75°C for 15 seconds and 95°C for 30 seconds.

3.3. Allele Specific PCR

Genotyping results of melting curve analysis were confirmed by Allele specific PCR using the following primers (1): Forward 1: 5’-AGCATTTGGTTTTAAATTATGGAGTATATT-3’; Forward 2: 5’-ATCTATAGTCATGCTGAAAGTAGGAGAAAG-3’; Common reverse: 5’-CTGAATAGTCCTACAGTGTTTTCAGTTTCA-3’

Primer F1 is specific for mutant allele and produces a 203 bp PCR product in the presence of p.V617F mutation. Primer F2 anneals to both mutant and normal alleles and generates a 364 bp PCR product. So it is used as an internal PCR control.

3.4. PCR-Direct Sequencing

PCR and direct sequencing of JAK2 exon 12 of all patients were carried out using the following primers:

F: TGAAATAACTGGCAGGAATACATC

R: GAGAACTTGGGAGTTGCGATA

The reaction contained 1× PCR buffer, 1.3 mM MgCl2, 0.27 mM of each dNTPs, 0.4 Pmol of each primer, 0.2 unit CinnaGen Taq DNA polymerase, 50 - 100 ng template DNA in 30 µL final volume.

PCR program was: 95°C for 5 min (pre-denaturation), followed by 30 cycles including 95°C for 50 sec, 63°C for 50 sec and 72°C for50 sec, and final extension of 72°C for 10 min.

Cycle sequencing was carried out by Macrogen Company (Seoul, Korea) (http://dna.macrogen.com/).

4. Results

One hundred and forty patients including 63 PV, 63 ET and 14 IMF cases as well as 79 individuals with idiopathic erythrocytosis were recruited to this study. Table 1 summarizes the genotyping results for Jak2 p.V617F somatic mutation detected in our patients.

No mutation was found in JAK2 exon 12 in these patients. But a kind of polymorphism (IVS11-90 A > G) was discovered in 33 IE patients as well as4 out of 6 negative controls.

Table 1. Frequency of Different Genotypes of JAK2 p.V617F (c.1849 G > T) Mutation Detected by Real-Time PCR on DNA Extracted From Whole Blood Samples
DiagnosisGenotyping with Melting Curve AnalysisPercentage of Mutation Negative (GG), %Percentage of Mutation Positive (GT + TT) , %
GGGTTTTotal
Polycythemia vera2142-6333.366.7
Essential thrombocytosis3033-6347.652.4
Idiopathic myelofibrosis77-145050
Idiopathic Erythrocytosis79--791000

5. Discussion

Due to the overlap in the clinical and laboratory features of the myeloproliferative disorders, the accurate diagnosis forthese patients can be difficult. The JAK2 mutations (such as JAK2 p.V617F and JAK2 exon 12 mutations) are associated with the pathogenesis of the myeloproliferative disorders (2, 10). The JAK2 mutations are reported in more than 95% of patients with polycythemia vera and in 50 to 60% of patients with essential thrombocythosis or idiopathic myelofibrosis (2). The estimated frequency of JAK2 p.V617F mutation is about 65% - 97% in PV, 30% - 57% in ET and 35% - 95% in IMF patients (1, 11-13).

In the present study, real-time PCR and allele specific PCR were applied to assess the JAK2 p.V617F mutation. We detected this mutation in 67% of PV samples, 50% patients with idiopathic Myelofibrosis and in 52.4% with essential thrombocytosis.

PCR-direct sequencing for studying JAK2 exon 12 mutations did not reveal any mutationin these patients. However, IVS11-90 A > G was found in 33 IE patients and 4out of 6 negative controls. This observation suggests the fact that the polymorphism is not just seen within the IE community so any relation between the disorder and the polymorphism is rejected.

The differences in the mutation percentages reported in myeloproliferative disorders may be due to the diagnostic criteria (PVSG and WHO), sensitivity of the methods and source of the DNA (1, 2, 6, 10).

According to the previous reports, the homozygous mutants have a low frequency (5% TT). In order to detect the homozygous form of JAK2 mutation, it is required to examine granulocytes extracted from peripheral blood (1, 10). Since the buffy coat was used in this study, all blood cell lineages existed in the samples and it was not possible to detect homozygous mutations. In other words, the heterozygotes we detected may be the combination of both heterozygotes and homozygotes for mutant allele (GT and TT). Further characterization can be performed using the DNA extracted from granulocytes.

Also detection limit of cycle sequencing method is about 10% of mutated allele (14, 15). So isolating DNA from whole blood instead of granulocytes may decrease the sensitivity of this method. This may be the reason we couldn’t find any mutation in JAK2 exon 12.

It is essential to evaluate serum erythropoietin (Epo) in patients suspected with polycythemia vera. In these patients the blood erythropoietin is low (2, 10). In the present study, we did not measure Epo levels in patients’ blood. Hence, patients who were suspected to suffer from polycythemia vera may be suffering from the other blood disorders.

Acknowledgements

Footnotes

References

  • 1.

    Murugesan G, Aboudola S, Szpurka H, Verbic MA, Maciejewski JP, Tubbs RR, et al. Identification of the JAK2 V617F mutation in chronic myeloproliferative disorders using FRET probes and melting curve analysis. Am J Clin Pathol. 2006;125(4):625-33. doi: 10.1309/TK0X-L917-XK2V-LRPQ. [PubMed: 16627272].

  • 2.

    Campbell PJ, Green AR. The myeloproliferative disorders. N Engl J Med. 2006;355(23):2452-66. doi: 10.1056/NEJMra063728. [PubMed: 17151367].

  • 3.

    Pagliarini-e-Silva S, Santos BC, Pereira EM, Ferreira ME, Baraldi EC, Sell AM, et al. Evaluation of the association between the JAK2 46/1 haplotype and chronic myeloproliferative neoplasms in a Brazilian population. Clinics (Sao Paulo). 2013;68(1):5-9. doi: 10.6061/clinics/2013(01)oa02. [PubMed: 23420150]. [PubMed Central: PMC3552438].

  • 4.

    Ghoreschi K, Laurence A, O'Shea JJ. Janus kinases in immune cell signaling. Immunol Rev. 2009;228(1):273-87. doi: 10.1111/j.1600-065X.2008.00754.x. [PubMed: 19290934]. [PubMed Central: PMC2782696].

  • 5.

    Levine RL, Wadleigh M, Cools J, Ebert BL, Wernig G, Huntly BJ, et al. Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell. 2005;7(4):387-97. doi: 10.1016/j.ccr.2005.03.023. [PubMed: 15837627].

  • 6.

    Jones AV, Kreil S, Zoi K, Waghorn K, Curtis C, Zhang L, et al. Widespread occurrence of the JAK2 V617F mutation in chronic myeloproliferative disorders. Blood. 2005;106(6):2162-8. doi: 10.1182/blood-2005-03-1320. [PubMed: 15920007].

  • 7.

    Ebid GT, Ghareeb M, Salaheldin O, Kamel MM. Prevalence of the frequency of JAK2 (V617F) mutation in different myeloproliferative disorders in Egyptian patients. Int J Clin Exp Pathol. 2015;8(9):11555-9. [PubMed: 26617890]. [PubMed Central: PMC4637706].

  • 8.

    Karimzadeh P, Ghaffari SH, Chahardouli B, Zaghal A, Einollahi N, Mousavi SA, et al. Evaluation of JAK2V617F mutation prevalence in myeloproliferative neoplasm by AS-RT-PCR. Iran J Pediatr Hematol Oncol. 2011;2(1).

  • 9.

    Scott LM. The JAK2 exon 12 mutations: A comprehensive review. Am J Hematol. 2011;86(8):668-76. doi: 10.1002/ajh.22063. [PubMed: 21674578].

  • 10.

    Scott LM, Tong W, Levine RL, Scott MA, Beer PA, Stratton MR, et al. JAK2 exon 12 mutations in polycythemia vera and idiopathic erythrocytosis. N Engl J Med. 2007;356(5):459-68. doi: 10.1056/NEJMoa065202. [PubMed: 17267906]. [PubMed Central: PMC2873834].

  • 11.

    Baxter EJ, Scott LM, Campbell PJ, East C, Fourouclas N, Swanton S, et al. Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet. 2005;365(9464):1054-61. doi: 10.1016/S0140-6736(05)71142-9. [PubMed: 15781101].

  • 12.

    Zhao R, Xing S, Li Z, Fu X, Li Q, Krantz SB, et al. Identification of an acquired JAK2 mutation in polycythemia vera. J Biol Chem. 2005;280(24):22788-92. doi: 10.1074/jbc.C500138200. [PubMed: 15863514]. [PubMed Central: PMC1201515].

  • 13.

    Wolanskyj AP, Lasho TL, Schwager SM, McClure RF, Wadleigh M, Lee SJ, et al. JAK2 mutation in essential thrombocythaemia: Clinical associations and long-term prognostic relevance. Br J Haematol. 2005;131(2):208-13. doi: 10.1111/j.1365-2141.2005.05764.x. [PubMed: 16197451].

  • 14.

    Sestini R, Provenzano A, Bacci C, Orlando C, Genuardi M, Papi L. NF2 mutation screening by denaturing high-performance liquid chromatography and high-resolution melting analysis. Genet Test. 2008;12(2):311-8. doi: 10.1089/gte.2007.0096. [PubMed: 18554169].

  • 15.

    Contini E, Paganini I, Sestini R, Candita L, Capone GL, Barbetti L, et al. A systematic assessment of accuracy in detecting somatic mosaic variants by deep amplicon sequencing: Application to NF2 gene. PLoS One. 2015;10(6). e0129099. doi: 10.1371/journal.pone.0129099. [PubMed: 26066488]. [PubMed Central: PMC4466335].

  • Copyright © 2019, Journal of Human Genetics and Genomics. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.
    COMMENTS

    LEAVE A COMMENT HERE: