Mutational Analysis of Mucopolysaccharidosis in Iranian Patients

AUTHORS

Seyed Hoseinali Saberi 1 , 2 , Shahla Farshidi 3 , Behnam Kamalidehghan 4 , Roshanak Jazayeri ORCID 5 , * , Massoud Houshmand 1 , **

1 Department of Medical Genetics, National Institute of Genetic Engineering and Biotechnology, Tehran, Iran

2 Medical-Genetic Counseling Center, Alborz Welfare Organization, Karaj, Iran

3 Prevention of Disability Department, Iran Welfare Organization, Tehran, Iran

4 Medical Genetics Department, Faculty of Medicine, Jiroft University of Medical Sciences, Jiroft, Kerman, Iran

5 Non-Communicable Diseases Research Center, Alborz University of Medical Sciences, Karaj, Iran

Corresponding Authors:

How to Cite: Saberi S H, Farshidi S, Kamalidehghan B, Jazayeri R, Houshmand M. Mutational Analysis of Mucopolysaccharidosis in Iranian Patients. Zahedan J Res Med Sci. 2021;23(3):e104794. doi: 10.5812/zjrms.104794.

ARTICLE INFORMATION

Zahedan Journal of Research in Medical Sciences: 23 (3); e104794
Published Online: August 8, 2021
Article Type: Research Article
Received: May 19, 2020
Revised: June 14, 2020
Accepted: July 5, 2020
Crossmark
Crossmark
CHECKING
READ FULL TEXT

Abstract

Mucopolysaccharidosis (MPS) is a rare and heterogeneous metabolic disorder with wide phenotypic distributions throughout the world. This study aimed to determine the genetic polymorphisms, contributing to the most common types of MPS in 19 unrelated Iranian patients. The sequence of the coding region and exon‐intron boundaries of the MPS genes were analyzed by Sanger sequencing method. We used the biochemical and clinical characteristics of MPS subjects for genetic analysis. A novel IDUA variant (c.99T>C, p.H33H), a novel nonsense change (c.514C>T, p.R172*) in exon 5 of IDS gene, c.74G > A (p. p.R24H) in SGSH gene, and three variants including (c.607C>T (p.R203*), c.259G>C (p.A87P), and c.683G>A (p.R228Q)) in NAGLU (n-acetyl-alpha-glucosaminidase) were predicted as novel pathogenic mutations. In conclusion, this study broadened genotypic spectrum of Iranian MPS patients, facilitating the definition of disease-associated mutations, which help to provide a more effective approach in MPS carrier detection.

1. Background

Mucopolysaccharidosis (MPS) is a set of inborn metabolic errors caused by an absence of specific lysosomal enzymes involved in glycosaminoglycan (GAG) catabolism (1). This metabolic block resulted in the GAGs accumulation in various organs, leading to progressive and multisystemic features (2). Based on the impairment of 11 involved enzymes, nine various clinical types and numerous subtypes of MPS have been identified (3). The subdivisions of MPS include Hurler Disease (MPS I), Hunter Syndrome (MPS II), Sanfilippo Syndrome (MPS III), Morquio Syndrome (MPS IV), Maroteaux Lamy Syndrome (MPS VI), Sly Syndrome (MPS VII), and hyaluronidase deficiency (MPS IX) (4).

It is very important to develop the genotypic catalog of specific disorders for a population. In this respect, there is inadequate research based on a limited number of cases in Iran. Therefore, the present study aimed to measure the rate of mutation and compare the data to the studies conducted in neighboring countries so as to identify the status of MPS disease in the Iranian population. Despite important information provided by genetic testing, there are limitations in this regard. Identification of common mutations prevents the need for next generation sequencing (NGS) based tests in MPS candidate patients. This results in lower diagnostic costs for patients and can be identified and categorized at a very low cost, and appropriate therapies can be considered.

2. Objectives

In this study, we examined the clinical and biochemical features and genetic analysis of 19 Iranian patients with MPS to identify novel MPS-associated mutations.

3. Methods

3.1. Ethical Statement

The sample included a total of 19MPS patients referred to the Taban Health Care and Diabetes Clinic (THCDC) from 2009 to 2015. The present study was approved by the Ethical Committee of National Institute of Genetic Engineering and Biotechnology (NIGEB) (IR.NIGEB.EC.1397.8.23.C), Tehran, Iran. Informed consent was obtained from patients. The clinical characteristics of MPS patients were summarized in Table 1.

Table 1. Epidemiologic and Clinico-Biochemical Features of Patients
PatientsMSP TypeSexPCMClinical FeatureMain SymptomFace AbnormalityBiochemical Urine GAG Accumulation DetectedMRCardiac ManifestationsDeafness
1MSP IM+Hepatospelnomegaly, spinal cord curvatureSever NDD, cloudy cornea, hearing lossCoarse face, irregular’s dental, gum hyperplasia, corneal opacityDS>HS+MI AIBT
2MSP IF+CVS######
3MSP IM+Skeletal deformity, stiff joint, respiratory infection, claw handDeafness, cloudy cornea, dolichocephalic, CHD, moderate NDDgum hyperplasia, cloudy cornea Coarse face,DS>HS+MI ASMixed
4MSP IF+Umbilical hernia, gargoyles, sever Hepatomegaly, mild splenomegalycloudy cornea 1 year, deafness 2yearsMild coarse face, irregular’s dentalDS, HS+MSBT
5MSP IM+Short stature, claw hand, dysostosis multiplexMacrocephaly, viceromegaly,cloudy cornea, Coarse face,DS>HS+MIMixed
6MSP IF+Seizure, hepatomegaly, short statureMacrocephal, ombelical herniaFacial dysmorphic features, mild Coarse faceDS, HSNMI AIP
7MSP IIM_dysostosis multiplex, Skeletal deformity; Hepatospelnomegaly, joint; stiffness; dolichocephaly, claw, handCarpal tunnel, large tongue, Hydrocephaly, repeated diarrhea, large; tongue, J-shape sella; turcicaCoarse face, clear cornea, hypertelorismDS, HS+Cardiomyopathy, ValvulopathyBT
8MSP IIM_AF######
9MSP IIIBM+Mild speech difficulty, insomnia, mild Skeletal deformity,Psychotic, ADHD, NDR, hairsotysm, mild speech difficultyModerate Coarse faceHD CS+NN
10MSP IIIBF+mild Skeletal deformity,Difficult moodCoarse faceND+ValvulopathyN
11MSP IIIAF+Mild speech difficultyAggressive behaviorMild coarse faceHS CS+NMILD BT
12MSP IIIBM+insomnia, mild Skeletal deformity,ADHD, hairsotysmHair sot faceHS+NN
13MSP IIIBF+moderate speech difficulty, mild short stature, Seizure,Hairsotysm, NDR, otitisMild coarse faceHSMild +NN
14MSP IIIAM+Seizure, mild short statureClaw hand, NDD, recurrent media otitisMPS like phenotypeHS DS CS+CardiomyopathyMixed
15MSP IIIBM+Mild speech difficulty, insomniaADHD, NDR,Mild coarse faceHS, CS+NN
16MSP IIIAM+Otitis media, speech difficulty,NDD, NDR, Claw, hand, Psychoticcoarse faceHs cs+NMixed
17MSP IIIAM+Seizure, Speech delayClaw hand, Hairsotysm Mild coarse faceND+ValvulopathyMILD BT
18MSP IIIAF+mild Skeletal deformityNDR, Aggressive behaviorMPS like phenotypeHS CS+NN
19MSP IIIAF+Insomnia, Skeletal deformity,ADHD, Psychoticcoarse faceNDMild+CHDMixed

3.2. DNA Extraction and Polymerase Chain Reaction (PCR)

Genomic DNA was extracted using PrimePrep Genomic DNA extraction kit (GeNet Bio) from peripheral blood samples of MPS patients, collected in tubes containing ethylenediaminetetraacetic acid (EDTA) in a final volume of 2 mL. Briefly, the PCR reaction was carried out in a total volume of 25 µL containing 50 ng of DNA, 2.5 µL of 10 × PCR buffer, 0.1 mM of each dNTP, 1 mM of MgCl2, 0.1 µM of each primer, and 0.3 units of Taq polymerase enzyme (CinnaGen, Iran) using a thermocycler (Eppendorf, Hamburg). The DNA was denatured at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 1 min. The annealing temperature was based on the temperature (°C) value of each primer set (Table 2). The extension temperature was at 72°C for 1 min, with final extension at 72°C for 10 min.

Table 2. Primer Sequences for IDUA, IDS, SGSH, and NAGLU genes
PrimersSequences
IDUAExon 1F-GAGTCATCGGTCCTCAGAGC
R-AGGACCCACCCACAAACAC
Exon 2F-CGCTGCCAGCCATGCTGAGGCTCG
R-CCTCCCATCTGTGCCTCTGTAAGG
Exons 3-4F-GGGTTATTTTCCAAGGGGAAG
R-CCAACCTATCCCTTGTCACC
Exons 5-6F-ATGCAGACGCCCTTCATC
R-CCTGCTCCAGGATGGAGA
Exons 7-8F-CCACGACGGTACCAACTTCT
R-TCCCCTTGGTGAAGGAGTC
Exon 9F-CTGGGGACTCCTTCACCAAG
R-CAGGTAGCGCGTGACGTA
Exon10F-GTAAGCCGGGGTTCCAGG
R-CGGTCCTCAGGGTTCTCC
Exon 11F-TGTGGGTGGGAGGTGGAG
R-GAGGGAAGGGCTGTGATGG
Exon 12F-ACAGTGTGTGGGGTGAAGG
R-TTGCTGGTGCACGTGTGT
Exons 13-14F-CCTAGGGGACATGAGATGGA
R-CTCCAGCTGGGTCCTCATC
IDSExon 1F- CTGTGTTGCGCAGTCTTCAT
R- ATGCAGGAAAGGACAGATGG
Exon 2F- CCATCTGTCCTTTCCTGCAT
R- TAACAAGATGTCCCGCACAA
Exon 3F- GCTGTGGCGATGCTTACCTCTG
R- AAGAGAACCCAGACTCTGGACA
Exon 4F- GGCTTAGGGACCAGGAAGTC
R- AACAAGTAGCACCCACCAGC
Exon 5F- CCTGCCTGGAAAACAAGAAA
R- GGCCTTGACCTCTAAATCCC
Exon 6F- ACGTGGGGAATGCTAGTGAG
R- GTTGGGAGAGTCCTGATCCA
Exon 7F- GCTGTGACTCTGTGGGTGAA
R- CCAGGTTAAAAATGGGGGTT
Exon 8F- CAGCCTGTCAAGAATGAGCA
R- ACCCCCAAAGCCTATGATTC
Exon 9F- CATATGGAGCCCAGACAGGT
R- GGAAGGGAGCACATCACATT
SGSHExon 1F- GAGACCAGAGAGCCGGAG
R- ATTGACCACGGGTGGGG
Exon 2F- CTCACTCCCAGTGCTGTTTC
R- GGGAGACGTGGCAGAGG
Exon 3F- GAGAACAGGTGCGGCAG
R- ACCTCCTGGGCTCTGGC
Exon 4F- GAAGGGAGCAGAAAGGGTTG
R- ATCCCGCCGGAAGACTC
Exon 5F- CCGAGGGGCTTCCTGTG
R- CAAGCTCGTAGGAGGCCAG
Exon 6F- GTTCTGGGCTAACCCATTTG
R- GACCCTCACCCACATTATGC
Exon 7F- GTCTACACACACCACCCGC
R- CCCGTCCCAGATCCACTC
Exon 8F- GAGGGCAGCTCCTGTGTG
R- CATCTCCAGAAGCTGAGCAA
Exon 9F- CTGGTACAAGGACCTCCGTC
R- AAGGACAACTGTGTCCCCTG
NAGLUExon 1aF- CCCAAGGGAGTATCCTGGTA
R- TGGCAGCCACAGAAGTCG
Exon 1bF- CTTGGACACCTACAGCCTGG
R- AGGCTCTGAAAGGCAGAGTG
Exon 2F- GGTACCTGGTCTCAGCTCCA
R- GAAAACACCTACGGTGGCTC
Exon 3F- CCAGCACAAAGAAGCAATGA
R- ATCTATCACCGATTCTGCCC
Exon 4F- CTGCGTGTATCCTGGGAGAT
R- GGAATAAAATTCCCTCTCTGAGC
Exon 5F- GTGAACACTATGGCGGCTTC
R- GTCCCTCTGCCTACCCCTAC
Exon 6aF- GCCCTCTGTTTCATCACTCC
R- GGTGGGAGACCCCATACC
Exon 6bF- TGGTCTATTCCCTCATGGCT
R- GTCACTAGCCAGCACCTCGT
Exon 6cF- CTATGAGGAGGCAAGAAGCG
R- AGCGGGGGTAATATTTGAGG
Exon 6dF- CGTTCTCAGCAAGCAGAGGT
R- TATAGCCCTGAGTCCTCCCA

3.3. Sequencing Analysis

The double-stranded DNA of PCR products from MPS patients was examined using an automated ABI sequencing machine (Applied Biosystems 3100, Kavosh Fanavaran Kawsar Company, Tehran, Iran). The DNA sequences were confirmed for any nucleotide variation and then analyzed using Finch TV software (http://www.geospiza.com/finchtv/).

3.4. In Silico Analysis of the Variants

The impact of novel mutations was verified through Human Gene Mutation Database (HGMD). In order to predict the functional effects of novel variations, the sequence changes were evaluated using in silico prediction algorithms SIFT (5), polyphen (6), and I-Mutant 2.0 (http://folding.biofold.org/i-mutant/i-mutant2.0.html).

4. Results

4.1. Epidemiological and Clinical Data

In this study, 19 unrelated Iranian MPS patients were affected by MPS I (31%), MPS II (10%), MPS IIIA (31%), and MPS IIIB (26%) (Table 1).

4.2. Sequence Analysis

All the coding exons and intronic boundary regions of the IDUA, IDS, SGSH, and NAGLU genes were assessed by polymerase chain reaction (PCR) in all patients. The list of primers used in this study was presented in Table 2. Direct sequencing of the PCR products showed 16 variants in these genes, among which two nonsense and three missense alterations had been reported in the disease databases previously and two variants were present in the local population database (http://www.iranome.ir) (Table 3).

Table 3. Exon Variants in the MPS Genes in Patients
PatientsMPS TypeGeneExon/ (Intron)VariantProtein ChangePoint Mutation TypeZygosityClinical Significance
1IIDUA1c.32T>Gp.L11RMissenseHomPolymorphism
2, 31c.T99GP.H33QMissensePolymorphism
41c.99T>Cp.H33HMissenseDisease Causing
59c.1205G>Ap.W402*nonsenseDisease Causing
61c.33G>TnormalsilentDisease Causing
7, 8IIIDS5c.514C>Tp.R172*nonsenseHemiDisease Causing
11IIIASGSH2c.150G>TnormalSilentHom
143c.256A>GP.N86DMissenseDisease Causing
16, 184c.364G>Ap.G122RMissenseDisease Causing
174c.456G>Ap.I152IMissenseDisease Causing
191c.74G>Ap.R24HMissenseLikely Pathogenic
9IIIBNAGLU3c.607c>Tp.R203*nonsenseHomDisease Causing
121c.259G>Cp.A87PMissensePolymorphism
103c.683G>Ap.R228QMissenseDisease Causing
15, 136c.2209C>Ap.R737SMissensePolymorphism

Except the mentioned variants, remaining variants were not found in the disease databases (Clin Var, OMIM, HGMD, and literature in PubMed till to Jul 29, 2019). Six variants were predicted as disease-causing by Mutation Taster.

4.3. Amino Acid Substitutions

Among the cases, six patients had single base-pair substitutions in IDUA gene, five of these variants were detected in exon 1, and a single base pair substitution (c.1205G>A) was detected in exon 9 of one sample. Of the five mutations identified in the IDUA gene, three mutations were the missense type leading to a change in the amino acid sequence, one mutation was the nonsens type that leads to creation of stop codon, and one mutation was the silent type.

We found a single base pair substitution (c.514C>T) in exon 5 of IDS gene in one sample. This mutation is of the nonsense type and leads to the formation stop codons. In addition, four single base-pair substitutions in NAGLU gene were detected in five samples, including a single base-pair substitution (c.2209C>A) in exon 6 of two samples, two single base-pair substitution (c.607c>T and c.683G>A) in exon 3 of two samples, and a single base-pair substitution (c.259G>C) in exon 1 of one sample. Of these four mutations, three were missense mutations, and one was nonsense mutation. Moreover, our data showed five single base-pair substitutions in SGSH gene in 6 samples, including a single base pair-substitution (c.74G>A) in exon 1 of one sample, a single base-pair substitution (c.456G>A) in exon 3 of one sample, and two single base-pair substitution (c.364G>A and c.456G>A) were found in two and one of our samples, respectively.

Of these five mutations, four were missense mutations, and one was silent mutation that does not alter the amino acid sequence (type of mutations was summarized in Table 3).

5. Discussion

MPS is a group of hereditary, rare, and incurable ‘lysosomal storage diseases’ (7). It is estimated that 1 in 25,000 newborn children will have some type of the MPS in the United States in 2013 (8). MPS demonstrates remarkable genotypic heterogeneity, explaining the association of genotype-phenotype variability (9, 10). The present study indicated clinical and molecular features of 19 patients from unrelated Iranian families, manifesting various biochemical and clinical characteristics of MPS disease. Additionally, MPS is promptly diagnosed through urine and blood biochemical analysis (8, 11). However, a definite diagnosis of different types of MPS requires a wide range of comprehensive biochemical and molecular genetic techniques (12). In this study, to evaluate mutations of IDUA, IDS, SGSH, and NAGLU genes, we sequenced 19 blood samples acquired from MPS patients using a Sanger sequencing method. In our study, 15 variants in these genes were reported in MPS patients, of which eight variants were novel. Out of 15 variants, 9 variants were disease-causing mutations. Of the changes in IDUA identified in this study, the novel change c.99T>C (p.H33H) was found in one patient, which was a disease causing one, and it had not been published previously. However, the other variant c.1205G>A (p.W402*) was disease causing, and it had been reported by Zanetti et al. in Italian population (13) and Atceken et al. in Turkish population (14). The IDUA gene contains 14 exons (15). It should be noted that in our study, 80% of IDUA mutations were found in exon 1, and only 10% were in exon 9. Chkioua et al. showed novel splice site mutation in intron 11 of IDUA gene in four MPS I patients from four families from northern Tunisia (16). Sánchez reported that 14% of the IDUA gene mutations in his 7-member population were in exons 5 and 9 (17). Chkioua et al. reported that exon 1 mutations were detected in 75% of the patients, and exon 9 mutations were detected in 25% of patients in eight families with MPS I (18). Therefore, our results are consistent with those of Chkioua et al. The novel nonsense change c.514C>T (p.R172*) in exon 5 of IDS gene was found in more than one patient (in 10% our sample size). This variant was predicted as disease causing. Chistiakov et al. analyzed 17 children with hunter syndrome and found exon 5 of IDS gene mutations in 27% of mutations (19).

Exon 5 of IDS gene mutation accounted for only 5.5% of the total mutations observed in the study by Zhang (20). SGSH gene contains 8 exons, and interestingly, all the novel mutations in this study were found in exons 1 to 4. Mutational analysis on 23 patients from the UK with Sanfilippo syndrome type A showed that 30% of total mutations were located in exons 1 to 4 (21).

Yassaee et al. showed that SGSH mutations were in exons 2 and 7 in 11 families (22). Of the 5 variants found in the SGSH gene, three variants (c.364G>A (p.G122R), c.456G>A (p. p.I152I), and c.74G>A (p. p.R24H)) were predicted as disease causing, and the last two variants were not reported in any population; however, c.364G>A had been published in 2000 by Beesley et al. (21). In the study of NAGLU gene variants, three variants including (c.607c>T (p.R203*), c.259G>C (p.A87P), and c.683G>A (p.R228Q)) were predicted as novel pathogenic variants. In addition, Yassaee et al. revealed that NAGLU mutations were located in exons 2, 5, and 6 (22); but our data demonstrated that NAGLU mutations were in exons 1, 3, and 6. Similar studies have been performed in different countries. For example, Bekri’s study described the clinical and molecular features of 13 Algerian MPS 1 patients by molecular study of the IDUA gene (23).

Moreover, in a study conducted in 2014, molecular studies were performed in seven Mexican MPS I patients, and p.W402X was listed as a common mutation (17). Vafiadaki et al. identified the primary genetic lesion in 57 unrelated Korean MPS II patients, and they found various types of mutation in 42 patients (24). In the study by Beesley et al., mutational analysis was performed on the sulphamidase gene from 23 patients in the UK. In the study by Beesley et al., mutational analysis was performed on the sulphamidase gene from 23 patients in the UK, and 13 different new mutations were found (21). Our results showed positive mutation spectrum of IDUA, IDS, SGSH, and NAGLU genes in the Iranian cohort. The high fraction of detected novel variants highlights the mentioned genes mutation heterogeneity. However, this heterogeneity generates challenges in the interpretation of genotype and phenotype correlation. Meanwhile, if these mutations are studied and proven in a larger sample population, they could help to identify and categorize the patients with MPS symptoms. Due to the MPS heterogeneity and the clinical picture complexity, whole exome sequencing (WES) is usually recommended to all clients as a first tire test in Iran, which is a time consuming and costly test. If we have Iranian common mutations in the mentioned exons of target genes, we can screen the patients with MPS symptoms and diagnose them earlier at a lower cost.

Acknowledgements

Footnotes

References

  • 1.

    Giugliani R, Federhen A, Rojas MV, Vieira T, Artigalas O, Pinto LL, et al. Mucopolysaccharidosis I, II, and VI: Brief review and guidelines for treatment. Genet Mol Biol. 2010;33(4):589-604. doi: 10.1590/S1415-47572010005000093. [PubMed: 21637564]. [PubMed Central: PMC3036139].

  • 2.

    Clarke LA. The mucopolysaccharidoses: a success of molecular medicine. Expert Rev Mol Med. 2008;10. e1. doi: 10.1017/S1462399408000550. [PubMed: 18201392].

  • 3.

    Muenzer J. Overview of the mucopolysaccharidoses. Rheumatology (Oxford). 2011;50 Suppl 5:v4-12. doi: 10.1093/rheumatology/ker394. [PubMed: 22210669].

  • 4.

    Jones S, Wynn R, Patterson MC. Mucopolysaccharidoses: Treatment. UpToDate [Database]. Wolters Kluwer. 2017.

  • 5.

    Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc. 2009;4(7):1073-81. doi: 10.1038/nprot.2009.86. [PubMed: 19561590].

  • 6.

    Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, et al. A method and server for predicting damaging missense mutations. Nat Methods. 2010;7(4):248-9. doi: 10.1038/nmeth0410-248. [PubMed: 20354512]. [PubMed Central: PMC2855889].

  • 7.

    Cleary MA, Wraith JE. The presenting features of mucopolysaccharidosis type IH (Hurler syndrome). Acta Paediatr. 1995;84(3):337-9. doi: 10.1111/j.1651-2227.1995.tb13640.x. [PubMed: 7780260].

  • 8.

    Tomatsu S, Fujii T, Fukushi M, Oguma T, Shimada T, Maeda M, et al. Newborn screening and diagnosis of mucopolysaccharidoses. Mol Genet Metab. 2013;110(1-2):42-53. doi: 10.1016/j.ymgme.2013.06.007. [PubMed: 23860310]. [PubMed Central: PMC4047214].

  • 9.

    Chkioua L, Aloui C, Laradi S, Grissa O, Turkia HB, Ouesleti S, et al. Genetic heterogeneity of 72 patients with mucopolysaccharidosis in Tunisia. Int J New Technol. 2015;1(3).

  • 10.

    Valstar MJ, Bruggenwirth HT, Olmer R, Wevers RA, Verheijen FW, Poorthuis BJ, et al. Mucopolysaccharidosis type IIIB may predominantly present with an attenuated clinical phenotype. J Inherit Metab Dis. 2010;33(6):759-67. doi: 10.1007/s10545-010-9199-y. [PubMed: 20852935]. [PubMed Central: PMC2992652].

  • 11.

    Leistner S, Giugliani R. A useful routine for biochemical detection and diagnosis of mucopolysaccharidoses. Genet Mol Biol. 1998;21(1):163-7. doi: 10.1590/s1415-47571998000100028.

  • 12.

    Emre S, Terzioglu M, Coskun T, Tokath A, Ozalp I, Muller V, et al. Biochemical and molecular analysis of mucopolysaccharidoses in Turkey. Turk J Pediatr. 2002;44(1):13-7. [PubMed: 11858372].

  • 13.

    Zanetti A, D'Avanzo F, Rigon L, Rampazzo A, Concolino D, Barone R, et al. Molecular diagnosis of patients affected by mucopolysaccharidosis: a multicenter study. Eur J Pediatr. 2019;178(5):739-53. doi: 10.1007/s00431-019-03341-8. [PubMed: 30809705]. [PubMed Central: PMC6459791].

  • 14.

    Atceken N, Ozgul RK, Yucel Yilmaz D, Tokatli A, Coskun T, Sivri HS, et al. Evaluation and identification of IDUA gene mutations in Turkishpatients with mucopolysaccharidosis type I. Turk J Med Sci. 2016;46(2):404-8. doi: 10.3906/sag-1411-160. [PubMed: 27511503].

  • 15.

    Menon KP, Tieu PT, Neufeld EF. Architecture of the canine IDUA gene and mutation underlying canine mucopolysaccharidosis I. Genomics. 1992;14(3):763-8. doi: 10.1016/s0888-7543(05)80182-x. [PubMed: 1339393].

  • 16.

    Chkioua L, Boudabous H, Jaballi I, Grissa O, Turkia HB, Tebib N, et al. Novel splice site IDUA gene mutation in Tunisian pedigrees with hurler syndrome. Diagn Pathol. 2018;13(1). doi: 10.1186/s13000-018-0710-3.

  • 17.

    Sánchez Suárez AL, Sánchez Suárez LM. [Genetic mutations and the relationship with clinical phenotype in patients with mucopolysaccharidosis type I in northeast Mexico]. Gac Med Mex. 2014;150(4):289-96. Spanish. [PubMed: 25098213].

  • 18.

    Chkioua L, Khedhiri S, Kassab A, Bibi A, Ferchichi S, Froissart R, et al. Molecular analysis of mucopolysaccharidosis type I in Tunisia: identification of novel mutation and eight Novel polymorphisms. Diagn Pathol. 2011;6(1). doi: 10.1186/1746-1596-6-39.

  • 19.

    Chistiakov DA, Kuzenkova LM, Savost'anov KV, Gevorkyan AK, Pushkov AA, Nikitin AG, et al. Genetic analysis of 17 children with Hunter syndrome: identification and functional characterization of four novel mutations in the iduronate-2-sulfatase gene. J Genet Genomics. 2014;41(4):197-203. doi: 10.1016/j.jgg.2014.01.007. [PubMed: 24780617].

  • 20.

    Zhang H, Li J, Zhang X, Wang Y, Qiu W, Ye J, et al. Analysis of the IDS gene in 38 patients with Hunter syndrome: the c.879G>A (p.Gln293Gln) synonymous variation in a female create exonic splicing. PLoS One. 2011;6(8). e22951. doi: 10.1371/journal.pone.0022951. [PubMed: 21829674]. [PubMed Central: PMC3150403].

  • 21.

    Beesley CE, Young EP, Vellodi A, Winchester BG. Mutational analysis of Sanfilippo syndrome type A (MPS IIIA): identification of 13 novel mutations. J Med Genet. 2000;37(9):704-7. doi: 10.1136/jmg.37.9.704. [PubMed: 11182930]. [PubMed Central: PMC1734705].

  • 22.

    Yassaee VR, Hashemi-Gorji F, Miryounesi M, Rezayi A, Ravesh Z, Yassaee F, et al. Clinical, biochemical and molecular features of Iranian families with mucopolysaccharidosis: A case series. Clinica Chimica Acta. 2017;474:88-95. doi: 10.1016/j.cca.2017.08.017.

  • 23.

    Tebani A, Zanoutene-Cheriet L, Adjtoutah Z, Abily-Donval L, Brasse-Lagnel C, Laquerriere A, et al. Clinical and molecular characterization of patients with mucopolysaccharidosis type I in an Algerian series. Int J Mol Sci. 2016;17(5). doi: 10.3390/ijms17050743. [PubMed: 27196898]. [PubMed Central: PMC4881565].

  • 24.

    Vafiadaki E, Cooper A, Heptinstall LE, Hatton CE, Thornley M, Wraith JE. Mutation analysis in 57 unrelated patients with MPS II (Hunter's disease). Arch Dis Child. 1998;79(3):237-41. doi: 10.1136/adc.79.3.237. [PubMed: 9875019]. [PubMed Central: PMC1717680].

  • Copyright © 2021, Zahedan Journal of Research in Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.
    COMMENTS

    LEAVE A COMMENT HERE: